Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: ClearCase_guy
I’m guessing that the phones cause cancer.

Not according to independent epidemiological studies over the time that cellphones or even wireless home phones have been in use. There has been no significant increase in gliomas or brain cancers during the period that cellular or wireless phones have been in use. If they did cause cancer it would show up in an overall increase in the incidences of such tumors. There has been no noticeable increase in the rate of such cancers over the rate that was present before the introduction of phone using the technology.

Even this study has some serious problems because only male rats developed gliomas, while the female rats exposed to the same radiation levels did not. That implies there is some other unknown causation at the core of the tumors not related to the radiation. Also the fact that the controls did not develop any tumors at all in a variety of rat bred for a predilection for such tumors is cause for concern. The level of exposure at nine hours per day at high levels of radiation is far beyond any reasonable real world exposure. Also the distances and blocking provided by a human brain and skull are completely different than those provided by a rat brain and skull. i.e. Rats are not complete human analogs for such exposures.

13 posted on 05/29/2016 1:25:02 PM PDT by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users continue..)
[ Post Reply | Private Reply | To 5 | View Replies ]


To: Swordmaker; exDemMom; SunkenCiv
“Brain cancer incidence between 1982 and 2013 has not increased in any age group except those aged 70–84… [but] the increase began in 1982 before mobile phones were introduced.” Chapman believes the increase of diagnoses comes from better overall diagnostics.
http://bigthink.com/laurie-vazquez/your-cellphone-absolutely-will-not-give-you-brain-cancer

Carroll points out that female rats were treated to the same signals—and there was no increase in their cancer rates. And a statistically significant increased incidence of brain cancer for male rats was only found for CDMA signals, not GSM.

That’s surprising because, while real-world GSM phones emit more radiation than CDMA phones, the experimental radiation exposure levels were held constant between parallel groups. And since the main difference between GSM and CDMA is their data standard, there should only be different impacts if DNA could be corrupted by binary code.

All that suggests the results could simply be a statistically random variation, especially since, as Carroll points out, even the elevated cancer rates were “well within the historical range.” Another expert called the study “statistically underpowered,” with a sample size too small to eliminate that kind of random variation. There’s no way to refute that explanation until more studies can reproduce this one’s results.
http://fortune.com/2016/05/29/cell-phone-cancer-study/

Why Most Published Research Findings Are False

A research finding is less likely to be true when the studies conducted in a field are smaller; when effect sizes are smaller; when there is a greater number and lesser preselection of tested relationships; where there is greater flexibility in designs, definitions, outcomes, and analytical modes; when there is greater financial and other interest and prejudice; and when more teams are involved in a scientific field in chase of statistical significance. Simulations show that for most study designs and settings, it is more likely for a research claim to be false than true.
http://journals.plos.org/plosmedicine/article?id=10.1371/journal.pmed.0020124

If the medical profession use higher statistical standards the quality of the articles would increase, but the number of accepted articles would go down. In a world of publish or perish this is not easy.

19 posted on 05/29/2016 2:46:11 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson