Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Making Mainframes Cool Again
Information Week ^ | 4/15/2016 | Steve Trautman

Posted on 04/18/2016 3:09:17 AM PDT by AdmSmith

Mainframe systems are still the backbone of much of today's IT infrastructure. Yet, finding IT talent to maintain these systems, and the COBOL and Fortran languages that support them, is becoming increasingly difficult.

The trouble is that all of the people who know how to maintain these systems -- while preparing to bolt on next-gen apps -- are aging out of the workforce, and there are no Millennials eagerly lining up to take their spots. Mainframes require knowledge of COBOL and Fortran, languages that are not considered particularly sexy these days. It's not hard to see why no one wants to learn these languages. Mainframe is dead. Long live the cloud. Right?

(Excerpt) Read more at informationweek.com ...


TOPICS:
KEYWORDS: cobol; fortran; mainframe
Navigation: use the links below to view more comments.
first 1-20, 21-40, 41-60, 61-76 next last
FORTRAN is still kicking. FORTRAN 15 will be released in 2018 http://j3-fortran.org/
1 posted on 04/18/2016 3:09:17 AM PDT by AdmSmith
[ Post Reply | Private Reply | View Replies]

To: ShadowAce

FORTRAN 15
June 2016 - Working draft available
July 2016 - WG5 straw ballot
February 2017- Committee draft available
March 2017 - WG5 ballot on committee draft
October 2017 - Draft International Standard available
November 2017 - Ballot on Draft International Standard
February 2018 - Final Draft International Standard available
April 2018 - Ballot on Final Draft International Standard
July 2018 - Standard published

https://software.intel.com/en-us/blogs/2015/09/04/doctor-fortran-in-one-door-closes


2 posted on 04/18/2016 3:14:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Wow. I haven’t messed with FORTRAN since ‘79. I hope the accursed punch cards are history...


3 posted on 04/18/2016 3:16:28 AM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Intel is still committed to FORTRAN.


4 posted on 04/18/2016 3:17:04 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

I programmed in Fortran for close to thirty years. What got me out of the ‘Biz’ wasn’t the programming, it was the ensuing documentation. When I first started a job that involved a one line code change plus testing and documentation took eight hours or so. When I left it was at least six month’s from start to finish plus almost a half a million dollars in overhead.

It was just too much...

Now I’m much happier doing what I’m doing.


5 posted on 04/18/2016 3:17:51 AM PDT by The Working Man
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Boy do I remember those days.

COBOL/CICS and JCL with VSAM structures.

DELETE/DEFINE files before loading them.

Fun stuff and pretty easy.

I even did Assembler for my old banks connections from the branches to the mainframe. Quickest code to read the deposit/withdraw information back and forth to the branches.


6 posted on 04/18/2016 3:20:45 AM PDT by CapnJack
[ Post Reply | Private Reply | To 1 | View Replies]

To: The Working Man

Yes, the documentation was terrible. But everything (?) evolves even FORTRAN.


7 posted on 04/18/2016 3:21:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith
An acquaintance is working with OpenVMS supporting legacy VMS systems. He tells me the average age of folks in the office in around 55 years.

Time to fire up the old PDP-10.

8 posted on 04/18/2016 3:30:30 AM PDT by billorites (freepo ergo sum)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

+1


9 posted on 04/18/2016 3:32:44 AM PDT by bassmaner (Hey commies: I am a' white male, and I am guilty of NOTHING! Sell your 'white guilt' elsewhere.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

I remember what was it, about 20 years ago, I threw away a deck of Cobol cards that were a language interpreter for something - think it was a tape management system.

Since then, I’ve consulted, been an employee, but now simply contract as a systems programmer.engineer exclusively for mainframes.

But don’t get me wrong - I agree with you premise, that no one knows Cobol or Fortran or any of those anymore.
And sadly, as far as the Internet goes, Cobol would have kicked the shit out of Java!


10 posted on 04/18/2016 3:41:11 AM PDT by djf ("It's not about being nice, it's about being competent!" - Donald Trump)
[ Post Reply | Private Reply | To 1 | View Replies]

To: billorites

OH MY SWEET HEART

That is the first thing I ever did on a computer, but the output was to a printer, and each round had to be printed out.

I was in high school in Dallas, 1977, and they had the printer and a phone connection to the mainframe at the Dallas Public Library.

Eventually taught myself Basic and Machine Language programming.


11 posted on 04/18/2016 3:41:19 AM PDT by wbarmy (I chose to be a sheepdog once I saw what happens to the sheep.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: AdmSmith

FORTRAN, PL/1 and COBOL were not hard to learn. PL/1 was my favorite.


12 posted on 04/18/2016 3:46:16 AM PDT by ConservativeMind ("Humane" = "Don't pen up pets or eat meat, but allow infanticide, abortion, and euthanasia.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

At 60, I can handle the COBOL/FORTRAN. What I can’t handle is the SOX BS and dealing with the people in India. Retired I shall stay...


13 posted on 04/18/2016 3:59:41 AM PDT by laker_dad
[ Post Reply | Private Reply | To 1 | View Replies]

To: wbarmy

Seriously, BASIC is one of my favorite languages!

It’s very english-like and works pretty much the way you want,

I would say Rexx, but then you get into comparisons with clists, etc.


14 posted on 04/18/2016 4:01:08 AM PDT by djf ("It's not about being nice, it's about being competent!" - Donald Trump)
[ Post Reply | Private Reply | To 11 | View Replies]

To: djf

I actually moved from Basic to PASCAL in college and tried my hand at that for awhile.

Now, I do nothing with programming. Life sent me in another direction.


15 posted on 04/18/2016 4:27:40 AM PDT by wbarmy (I chose to be a sheepdog once I saw what happens to the sheep.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: AdmSmith
Interesting article. I'd add that the companies need to involve their own people, not just contractors. They also need to verify the skills. There are too many contractors who claim to have a skill and then read the manual the night before.

Worked on one project to move key applications off a mainframe. The replacement system would have been more flexible but required over a hundred servers to replace 1/3 of one mainframe LPAR. When management saw the cost, the whole project was cancelled. Ironically, the best replacement configuration turned out to be...a mainframe supporting virtual servers.

16 posted on 04/18/2016 4:28:12 AM PDT by Dilbert56
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dilbert56

And my first daughter’s birth announcements, in 1983, were sent out on punched cards.


17 posted on 04/18/2016 4:28:59 AM PDT by Dilbert56
[ Post Reply | Private Reply | To 16 | View Replies]

To: ConservativeMind

Once you know one programming language, moving to another is usually pretty easy. It should only take someone skilled in the more modern languages a week to learn COBOL. The hardest part might be doing without all the Object Oriented language features they regularly use.

The hardest languages to learn were Lisp and (especially) Prolog, because they are so fundamentally different from the others.


18 posted on 04/18/2016 4:35:38 AM PDT by rbg81 (Truth is stranger than fiction)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Smokin' Joe

They parked the punch cards in the common block. ;-P


19 posted on 04/18/2016 4:37:05 AM PDT by MortMan (Let's call the push for amnesty what it is: Pedrophilia.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: wbarmy
I actually moved from Basic to PASCAL in college and tried my hand at that for awhile.

When I took Introduction to Programming MATH 105H in 1982, we had to use STANDARD PASCAL on a DEC-20. NO STRING HANDLERS! Characters (other than the occasional WRITELN) had to be handled one character at a time.

I have had an aversion to it ever since.
20 posted on 04/18/2016 4:40:27 AM PDT by Dr. Sivana ("There is no limit to the amount of good you can do if you don't care who gets the credit."-R.Reagan)
[ Post Reply | Private Reply | To 15 | View Replies]


Navigation: use the links below to view more comments.
first 1-20, 21-40, 41-60, 61-76 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson