Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,941-9,9609,961-9,9809,981-10,000 ... 19,001-19,020 next last
To: BeauBo; PIF; gleeaikin; FtrPilot
Кремлевская табакерка

Black Swan for Kadyrov. What Happened to the Downed Azerbaijan Airlines Plane

We were in no hurry to publish this information, but it is now obvious that the Azerbaijan Airlines plane, which was flying from Baku to Grozny, was most likely shot down. A tragedy, of course. But it is worth paying attention to a number of points. Fact one. The conflict around Wildberries dealt a serious blow to Ramzan Kadyrov’s positions, but after Assad's escape and the change of power in Syria, the head of Chechnya got a second chance . Sources say that Kadyrov persistently asked the president to close the skies over Chechnya more tightly. “He was wildly enraged by the attacks on Grozny. Several Pantsirs were urgently transferred there, but not only them. They were removed in the Moscow region,” the source told us. At the time of the Azerbaijan Airlines plane's attempt to land, Chechnya was attacked by drones. And, most likely, the aircraft with passengers was attacked by mistake, sources say.

Fact two. The plane crashed in Kazakhstan - and that's bad. We don't have access to the crash site. Many noted the oddity that instead of Makhachkala or Vladikavkaz, the plane flew all the way to Aktau. An explosion inside the plane is not confirmed, because more than half an hour passed from the moment the distress signal was sent to the moment of the crash.

Fact three. This whole story will hit not only Kadyrov, but Russia as a whole. But as for Kadyrov, it is worth paying attention to a subtle detail. One of the first to publish information about the possible downing of the plane by the air defense system was Yuri Podolyaka. Rumor has it, not without instructions from Sergei Kiriyenko. It is not hard to guess - not everyone likes Kadyrov to feel special and important again. Sources say that Kiriyenko is actively looking for another negotiator to resolve the Syrian issue.

Considering that Ilham Aliyev has very close relations with Erdogan, after the downed Azerbaijan Airlines plane, Erdogan can protect the new Syrian authorities from contacts with Kadyrov. This is a non-obvious point. Grozny was defended, but at what cost. And yes, if Kadyrov thinks that he was awarded an order, that he came to an agreement with Zolotov and Dyumin, posted a photo with Vaino, and everything worked out for him, then we have very bad news for him. Ramzan Akhmatovich is very much mistaken.

https://t.me/kremlin_secrets/5085

9,961 posted on 12/25/2024 11:47:48 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9938 | View Replies]

To: BeauBo

“...In the 2010’s, Russia exported arms to over 60 countries. This year, only 11.

It is not just a wartime pause, those customers are now overwhelmingly buying Western weapons instead...”

That is a huge loss for the Russian economy and Russian prestige.


9,962 posted on 12/26/2024 12:53:32 AM PST by Monterrosa-24 (Saludemos la patria orgullosos)
[ Post Reply | Private Reply | To 9959 | View Replies]

To: Monterrosa-24

https://www.youtube.com/watch?v=lWK_euAwrMk

I’m old enough that this isn’t telling me much that I didn’t already know except for a handful of small details. Nevertheless, it points out some very hard truths about Russian behavior and why Europe looks the way it does.

TLDR: Russia-defenders don’t have a leg to stand on. Russian behavior has been so brutal, so barbaric, over the centuries that it’s debatable who has been the worst historical actor over the last 225 years: them or Nazi Germany. Their hands are the opposite of “clean”.


9,963 posted on 12/26/2024 1:04:07 AM PST by Windcatcher
[ Post Reply | Private Reply | To 9962 | View Replies]

To: Monterrosa-24
25DEC: We now have 5 Russian ships that are very likely heading to Tartus to aid in the evacuation travelling in 2 groups:

Currently north of Algeria:
- Ivan Gren
- Alexandr Otrakovsky
- Sparta

Currently just east of Denmark:
- Sparta II
- General Skobelev
https://x.com/OAlexanderDK/status/1871924292776325545

This local Spanish fisherman, Cirilo Butano, expects choppy waters in the Strait of Gibraltar.


9,964 posted on 12/26/2024 2:35:38 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9962 | View Replies]

To: AdmSmith

Ukraine has previously been able to sabotage Russian ships, by putting bombs on board.


9,965 posted on 12/26/2024 3:00:29 AM PST by BeauBo
[ Post Reply | Private Reply | To 9964 | View Replies]

To: AdmSmith

Maybe Turkey will covertly allow a ship smuggling Ukrainian naval drones through the Bosporus Straits, to hunt those Russian ships in the Med.

Or perhaps a friendly country will allow some to fly in, or even deliver their own production to Ukrainian operators in the Med.


9,966 posted on 12/26/2024 3:18:25 AM PST by BeauBo
[ Post Reply | Private Reply | To 9964 | View Replies]

To: gleeaikin

I had forgotten that the 25th was an important Jewish date this year, perhaps you have something there


9,967 posted on 12/26/2024 3:47:54 AM PST by blitz128
[ Post Reply | Private Reply | To 9958 | View Replies]

To: Windcatcher

Mao-tse-tung wins hands down.


9,968 posted on 12/26/2024 4:03:58 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9963 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Brutal: Ukrainian Special Ops Take No Prisoners ]


Today [ Dec 25, 8 pm ], the most interesting developments come from the Kursk direction.

Here, in defense of their objective, Ukrainians devised a clever plan to turn the tables on the battlefield, using the North Korean numbers advantage against them.

As cluster bombs and artillery rained down upon the North Koreans, Ukrainians sent in special forces operators to clear the area of any survivors and take prisoners; but as North Koreans were not willing to surrender, it led to a series of brutal confrontations.

The main Ukrainian goal is to defend Kruglenkoe, to prevent North Koreans from using the capture of the settlement to penetrate further toward Malaya Loknya, a key settlement holding together the Ukrainian defense of the entire northern part of the Kursk salient.

It is important to note that the main value of Kruglenkoe is not the size of the village, as less than 50 people would’ve lived here before the war. Instead, the main value of Kruglenkoe is the forests surrounding the settlement and, most importantly, the basements of the houses here, which allows for the concealed gathering of forces and ammunition, making it a launching pad for further infiltration assaults through the forests on Malaya Loknya.

As North Koreans had already established a foothold in the forests during the initial stages of their assault, pushing them back out was not a viable option for Ukrainians, as the North Koreans vastly outnumbered them.

This meant that to achieve their goal of stopping the North Korean breakthrough to Malaya Loknya, Ukrainians had to conceive a clever plan to turn the North Korean reliance on their numbers advantage into a weakness.

The plan was simple, force North Koreans into tactically disadvantageous positions, undermine their combat capabilities, and conduct counterattacks to eliminate the remaining forces, and gather reconnaissance.

As you remember from a previous report, Ukrainians already completed the first phase of the operation, conducting a tactical withdrawal from the narrow forests leading to Kruglenkoe.

As North Koreans were initially spread out across the bigger forest to the west, North Koreans were now forced to concentrate their forests along a narrow corridor, allowing Ukrainians to eliminate the threat most effectively with HIMARS cluster bombs.

Newly released footage shows how the North Korean forces tried to deploy fresh troops to the forests to try and attack the village nonetheless. The footage shows a huge column of North Korean soldiers making their way through the forest, trusting that the trees would obscure them.

Unfortunately for North Koreans, Ukrainians were heavily monitoring the area with drones, as their heat signatures were highly visible, in contrast to the snowy and cold underground. Ukrainian artillerymen immediately opened fire on the bunched-up North Koreans, decimating the entire assault group with a mix of conventional artillery and cluster rounds.

After the large majority of North Korean soldiers were wiped out by artillery, Ukrainians sent in special forces operators to conduct raids on the North Korean positions and clear the area, preventing them from gradually building up a sizable assault force from the remnants of failed attacks.

The Ukrainian special forces tactfully moved through the forest, clearing dugouts with grenades and finishing off any soldier unwilling to surrender.

As it turns out, reports from Ukrainian soldiers who have fought against the North Koreans report that their enemy often refuses to surrender, even in cases where they have no other way out.

One soldier comments on how they were forced to shoot a North Korean who was faking a surrender, as he tried to pull the pin on a grenade on them, once they came close to take him captive.

Overall, Ukrainians have conceived a plan to deal with the new North Korean threat most effectively, turning the North Korean reliance on overwhelming attacks through their superiority in numbers, into a stark disadvantage.

By putting North Korean forces in a tactically disadvantageous position and destroying their forces accumulations in bulk, Ukrainians managed to break the forward momentum of their attacks, and launch a series of successful counterattacks.

As North Koreans actively continue to funnel more troops into the forests, it is expected that Ukrainians will need to rinse and repeat their operation, till they have either completely drained the North Koreans of their reserves, or have forced the North Koreans to pull back for reorganization, creating a win-win scenario in both cases.


9,969 posted on 12/26/2024 4:05:32 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9966 | View Replies]

To: Windcatcher

No one’s hands are clean, that is true, but Russia/soviet union’s actions over the years makes Nazi Germany’s actions look almost amateur. Perhaps because of the length of time the “3rd reich “ existed and the damage it could do, but Russian history of aggression and oppression is long and well documented.

My position on the invasion of Ukraine remains the same. Putin used the cover of “threat to Russia” Nazis…… to fulfill his dreams of a greater Russia. As they did in Georgia and Chechnya.
Putin realized that he had to take Ukraine now, or he would never be able to if Ukraine joined NATO.


9,970 posted on 12/26/2024 4:25:23 AM PST by blitz128
[ Post Reply | Private Reply | To 9963 | View Replies]

To: Monterrosa-24

Curious how much arms they are even able to export even if nations wanted them.

General performance of Russian weapons systems during this war would not inspire confidence regardless of the price


9,971 posted on 12/26/2024 4:28:44 AM PST by blitz128
[ Post Reply | Private Reply | To 9962 | View Replies]

To: PIF; FtrPilot; AdmSmith; BeauBo
"F/A-18F Was Shot Down by Friendly Fire as Jets Were About to Land on The Carrier The friendly fire incident also came amid a sustained Houthi drone and missile attack targeting the Harry S. Truman Carrier Strike Group."

There is new information on the Truman's friendly fire F-18 downing:

  1. It was certainly friendly fire from the USS Gettysburg, not Houthis.

  2. It happened around 3:00 AM during the final landing approach of F-18s from a mission over Yemen.

  3. The simplest explanation is, there was a failure of the F-18s' IFF (identify friend or foe) system signals.

  4. There were many Houthi drones & missiles aimed at the Truman, which were being shot down by Gettysburg.

  5. Somehow, Gettysburg -- perhaps on "automatic" mode? -- mistook the landing F-18s for Houthi drones.

  6. Gettysburg fired two anti-aircraft missiles at two approaching F-18s.

  7. The first missile hit the first F-18 lined up to land on the Truman, the crew ejected just barely in time.

  8. The result was a gigantic "W.T.F.!!!" which may have jolted the Gettysburg's missile operator to hit the second missile's "abort" button just in time to prevent it from hitting the second F-18.
None of this is official -- all is just highly educated speculation, but to me sounds right on the money.

Carrier night landing -- Gettysburg missile launch:

9,972 posted on 12/26/2024 4:33:48 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9903 | View Replies]

To: BeauBo

All that is very good, Putin is hollowing out so much of foundational Russia and undermining its place in the world, while locking Russia into a diminished future with great quality and quantity losses in his workforce.

What he sees for Russia in the 2030s today can’t be what he envisioned for that future 3 years ago.


9,973 posted on 12/26/2024 5:43:39 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 9959 | View Replies]

To: BroJoeK; All
While anything is possible in the "Fog of War" scenario, I believe the most likely scenario is:

The Houthi's do have a Surface-to-Air capability.

The Houthis shot at the F-18s and damaged one of the F-18 aircraft.

The F-18s returned to the carrier, and performed a "controlability check" to determine the slowest airspeed he could control the aircraft.

That airspeed was determined to be too fast to land safely on the carrier.

The pilots performed a controlled bail out and were picked up by SAR helicopter.

In a combat scenario, the returning aircraft would fly specific routes to and from the carrier.

There would be specific routes for no radios (NORDO) or no IFF.

Entering carrier controlled airspace, the F-18s would make radio contact and would be told to squawk certain codes for ID.

If IFF could not be confirmed (IFF out), the pilot would then fly the IFF out flight route. He would be vectored for a Carrier Controlled Approach (CCA).

Another option would be to fly close formation on the F-18 that had a good IFF.

All the above is speculation. However, IMHO "battle damage" is more likely than "friendly fire".

Thanks for the ping.

9,974 posted on 12/26/2024 7:00:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9972 | View Replies]

To: FtrPilot

Kremlin snuff box, 12/26/24
https://t.me/s/kremlin_secrets

Kadyrov believes that the passenger plane in Chechnya was shot down on purpose. And I am sure that the attack was directed against him personally

We wrote [ https://t.me/kremlin_secrets/5085 ] about how the crash of the Azerbaijan Airlines plane could hit Kadyrov personally. It seems that Ramzan Akhmatovich is aware of the threat.

“The plane in Grozny was shot down on purpose. They couldn’t protect us from drones [ https://t.me/kremlin_secrets/5037 ], but then a whole plane was shot down. This is no accident. The devils want to cause problems for me personally,” the Chechen leader said in communication with people from his circle.

According to a source close to Kadyrov, Ramzan Akhmatovich “will not leave it like this.” And he will take revenge - both on the direct “culprits” from the air defense, who, according to him, fired at the passenger plane, and on the “customers” of this crime.

At the same time, our interlocutors in the Kremlin and law enforcement agencies are still reluctant to comment on the emergency. But some admit that there are forces that want to take advantage of the situation with the plane crash and “punish Ramzan for all his sins.”

A decision on punishment has not yet been made. Therefore, at the official level, the emergency with the plane is now being commented on with restraint [ https://t.me/rian_ru/274776 ].


9,975 posted on 12/26/2024 8:07:54 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9974 | View Replies]

To: BeauBo

Kremlin snuff box, 12/26/24
https://t.me/s/kremlin_secrets

Lavrov sent a strong signal to Trump, but the Kremlin is unhappy

Sergei Lavrov’s statement [ https://t.me/bbbreaking/197024 ] that a truce would be a “path to nowhere” and that Russia needs “reliable agreements” caused an unexpectedly wide response. And we also have something to say.

Firstly, the parties draw the framework for the upcoming negotiations. Lavrov’s statement, as our sources in his circle say, is a signal to Donald Trump. But not only him. In fact, Moscow again demands from Kyiv an official renunciation of four new regions and Crimea ( and this is at a minimum ).

Secondly, many interpreted these statements as Russia’s categorical unwillingness to make concessions on the issue of territories. And then there is a moment. Some interlocutors from the President’s circle made it clear that in the event of global negotiations ( not only about Ukraine ), the issue of territories will be on the table.

And by that time, it is necessary to liberate the entire territory of the Kursk region. Given Assad’s flight and weakening positions in Syria [ https://t.me/kremlin_secrets/5003 ], Russia needs arguments to demonstrate its intentions.

“This statement by Lavrov was not coordinated with the Kremlin,” the source said, noting that many in the Kremlin were surprised by the Foreign Minister’s words ( although they do not go beyond the general framework of Moscow’s tough position ).

Thirdly, the political bloc of the AP noted that we simply have no one to build “reliable agreements” with, so most likely we will face a difficult negotiation process. And you shouldn’t rely on Trump again.

By the way, there are rumors that instead of a bilateral meeting between Putin and Trump, a trilateral meeting could be organized with the participation of the Chinese leader, but this format does not entirely suit Vladimir Putin.

“In the format of bilateral negotiations, opinions are exchanged, common ground is sought. In the case of trilateral negotiations, many issues can be resolved with minimal participation of Russia, this does not suit us,” said the source in the Kremlin. However, he did not answer the question whether Putin would refuse this format of negotiations, if it were proposed.


9,976 posted on 12/26/2024 8:13:54 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9966 | View Replies]

To: BeauBo
According to Bloomberg, a Russian gas tanker has traveled halfway around the world in 4 months but has not found a buyer.

The Pioneer tanker was spotted on satellite imagery picking up its first shipment from Arctic LNG 2 in early August. The tanker then spent more than four months looking for a customer willing to circumvent US restrictions.

https://x.com/wartranslated/status/1872264382379618699


9,977 posted on 12/26/2024 9:18:30 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9974 | View Replies]

To: FtrPilot
Azerbaijani government sources have exclusively confirmed to Euronews on Thursday that a Russian surface-to-air missile caused the Azerbaijan Airlines plane crash in Aktau on Wednesday.

According to the sources, the missile was fired at Flight 8432 during drone air activity above Grozny, and the shrapnel hit the passengers and cabin crew as it exploded next to the aircraft mid-flight.

Government sources have told Euronews that the damaged aircraft was not allowed to land at any Russian airports despite the pilots’ requests for an emergency landing, and it was ordered to fly across the Caspian Sea towards Aktau in Kazakhstan.

According to data, the plane's GPS navigation systems were jammed throughout the flight path above the sea.

https://www.euronews.com/2024/12/26/exclusive-preliminary-investigation-confirms-russian-missile-over-grozny-caused-aktau-cras

The Russians hoped that this would lead to the plane crashing into the Caspian Sea and that there would be no forensic evidence pointing to Putin's villains.

9,978 posted on 12/26/2024 11:25:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9977 | View Replies]

To: AdmSmith

Reports from a Russian channel saying Ukraine was conducting a follow up drone strike on the Chechen Interior Ministry’s Akhmat-Grozny OMON Base, obviously a legitimate MILITARY target. Ukraine struck this base just last week. Twisting Ukraine’s attack into the cause of the shootdown is pretzel logic. Refusing an emergency landing and sending the jet hundreds of miles to Kazakhstan, across the Caspian was murder. The reasoning will be interesting, but I suspect they figured they figured a crash at sea would mean no evidence, and they could stick with the “bird strike” story.


9,979 posted on 12/26/2024 12:52:13 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 9978 | View Replies]

To: FtrPilot

“a Russian gas tanker has traveled halfway around the world in 4 months but has not found a buyer.”

When someone says that sanctions have had no effect on Russia, look at the the Arctic LNG 2 project. It was planned to make Russia a major player in the LNG market, and has been completely shut down by sanctions, with no restart date.


9,980 posted on 12/26/2024 1:02:51 PM PST by BeauBo
[ Post Reply | Private Reply | To 9977 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,941-9,9609,961-9,9809,981-10,000 ... 19,001-19,020 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson