Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,041-9,0609,061-9,0809,081-9,100 ... 22,561-22,564 next last
To: ANKE69

9,061 posted on 12/04/2024 3:26:40 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9025 | View Replies]

1 670, i.e. more than 1.15 Russians and NorKs/min


9,062 posted on 12/04/2024 3:31:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9017 | View Replies]

To: BeauBo

Russia’s Prized Bases Along The Mediterranean In Syria Could Be At Risk
With Russia’s resources being poured into its war in Ukraine, defending its naval base and airfield in Syria would be more of a challenge than three years ago.
https://www.twz.com/air/russias-prized-bases-along-the-mediterranean-in-syria-could-be-at-risk


9,063 posted on 12/04/2024 3:37:23 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9057 | View Replies]

To: BroJoeK
1-JS259041968
9,064 posted on 12/04/2024 3:41:38 AM PST by ANKE69 (✌️🇺🇲 Let's MAGA)
[ Post Reply | Private Reply | To 9061 | View Replies]

To: BeauBo

The Navy’s Amphibious Fleet Is In Really Bad Shape
The ‘Gator Navy’ is facing a major readiness crisis with no near-term relief in sight, according to a scathing report from the Government Accountability Office.
https://www.twz.com/sea/the-navys-amphibious-fleet-is-in-really-bad-shape


Surprise Martial Law Declaration Throws South Korea Into Turmoil (Updated)
South Korean troops appeared at the country’s parliament and elsewhere in the capital after President Yoon Suk Yeol’s declaration.
https://www.twz.com/news-features/surprise-martial-law-declaration-throws-south-korea-into-turmoil


9,065 posted on 12/04/2024 3:45:13 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9057 | View Replies]

To: AdmSmith
The Russian occupier tried to show his acting talent and imitate suicide as authentically as possible in front of the 60th Brigade drone hovering over him.

But such a performance would have been successful in the summer, and now it's winter.

As you know, in winter, breathing gives off steam, which the students of the acting school of the Russian Ministry of Defense apparently forgot to tell.

https://x.com/wartranslated/status/1864264808960266732


9,066 posted on 12/04/2024 4:12:52 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9059 | View Replies]

To: PIF
An explosive gift from the soldiers of the 🇺🇦 Ukrainian 10th Mountain Assault Brigade. 💪🔥

It would have been better if he had stayed at home

https://x.com/GloOouD/status/1864191923163955580


9,067 posted on 12/04/2024 4:17:42 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9066 | View Replies]

To: BroJoeK

Ex-Polish gov't official claims up to 50% of financial aid given to Ukraine has been embezzled.

Former Deputy Minister Piotr Kulpa accused US aid programs of giving massive bonuses to Ukrainian officials.

Trying to influence Ukrainians the ‘US way‘. pic.twitter.com/zBbJq6DODu— Alternative News (@AlternatNews) December 4, 2024


9,068 posted on 12/04/2024 4:18:10 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9060 | View Replies]

To: PIF
Putin's niece accidentally revealed the approximate number of missing Russian soldiers.

Russian authorities have received 48,000 applications for DNA tests to find missing Russian soldiers. This was announced in Russia's Duma by Russian Deputy Defense Minister, Anna Tsivilyova, Putin's niece.

Kartapolov, head of the Duma's defense committee, said this was "secret information," asked that "these figures not be voiced anywhere else" and that the information be removed from the documents.

These numbers are likely on the lower end of the scale of Russian casualties. There is a reasonable probability that the actual numbers are much higher.

https://x.com/Gerashchenko_en/status/1864272538307633509


9,069 posted on 12/04/2024 4:25:55 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9067 | View Replies]

To: PIF
"The Palianytsia missile project has entered mass production." - Umerov says.

According to the defense minister, mass production of R-360 cruise missiles of the Neptune complex has also been resumed and scaled up. The modified missiles are now capable of hitting targets at a longer range.

https://x.com/wartranslated/status/1864262286598197248


9,070 posted on 12/04/2024 4:35:43 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9069 | View Replies]

To: BeauBo
INSTANT KARMA: The German company Helsing produces the HX-2 “Karma”, an Al empowered strike drone.

It can engage point targets 'over the horizon’ at ranges of 60 KM on the battlefield.

https://x.com/ChuckPfarrer/status/1864137901094715735


9,071 posted on 12/04/2024 4:44:53 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9070 | View Replies]

To: PIF
The crew of a T-64BV from the 17th Mechanized Brigade targets buildings housing Russian forces in the village of Dari'no, Kursk region

https://x.com/NOELreports/status/1864289617605697779


9,072 posted on 12/04/2024 4:48:49 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9071 | View Replies]

To: PIF
UAV operators of the 47th Mechanized Brigade continue to destroy Russian equipment and personnel in the Kursk region.

https://x.com/NOELreports/status/1864285895827882414


9,073 posted on 12/04/2024 4:50:30 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9072 | View Replies]

To: All
Some good news from the Kursk region.

I got confirmed the 225th Assault Batallion made progress around Dar'ino.

It is too early to exactly draw how the map looks like, and the attack is very local and uncertain, but it seems they managed to push out Russian forces from important positions.

https://x.com/NOELreports/status/1864269266100387898


9,074 posted on 12/04/2024 5:33:37 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9073 | View Replies]

To: PIF
🔥 At night, explosions reported near the Dyagilevo airbase in Ryazan and the port in Novorossiysk, home to missile carriers.

Explosions were also heard in Taganrog and Bryansk.

https://x.com/NOELreports/status/1864196719098945984


9,075 posted on 12/04/2024 5:39:15 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9074 | View Replies]

To: FtrPilot
Soldiers of the Russian invasion army deployed in the combat zone are being given instructions by their commanders for committing suicide, thus discouraging them from surrender

The headline calls for ‘retaining dignity till the end’ and describes the algorithm for committing suicide using a firearm or grenade. The ‘soldier of Great Russia’, if facing a critical situation, is ordered to shoot himself in the temple, under the chin or in the forehead,” the report says.

As noted, the instructions state that “it is important to remain calm and confidently pull the trigger.” And if there is no weapon or ammunition available, soldiers are advised to use a grenade.

https://www.ukrinform.net/rubric-ato/3934170-russian-soldiers-fighting-in-ukraine-given-suicide-instructions-intel.html

Die for the tZar or Death to the tZar!

9,076 posted on 12/04/2024 5:44:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9066 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Generals Panic! Russian Soldiers’ Life Expectancy Drops to Just 14 Days! ]


Today [ Dec 03, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction [ Adviika ].

Here, desperately attempting to reach Myrnohrad before winter halts their advance, Russian forces ramped up the intensity of their assaults on the town’s defenses to up to 10 times per day.

However, the success rate of these attacks is so low that, as the recently released reports reveal, it single-handedly dropped the average life expectancy of Russian soldiers in this sector to just 2 weeks.

The main Russians goal here is to reach the outskirts of Myrnograd and initiate urban combat. Securing a foothold in the town’s southern part would provide a base for operations and facilitate further incremental gains through urban warfare.

Failure to establish this foothold now, would force them to contend with muddy terrain, delaying advances until the ground freezes in January or February.

Aware of the severe time constraints, Russian generals are intensifying their efforts, reportedly launching up to ten assaults daily on Myrnograd alone. However, none of these attacks have succeeded, largely due to the resilience of the Ukrainian 38th Marine Brigade.

Footage highlights well-established trenches, constructed precisely according to military guidelines and proportions. This demonstrates how Ukrainian forces capitalized on Russia’s failure to make gains over months of assaults, using the time to strengthen their defenses and fortify positions to counter Russian offensives effectively.

Ukrainian forces have honed their artillery tactics to devastating effect, targeting Russian troop concentrations and adding significantly to their casualties. To preempt assaults, Ukrainian forces track Russian stormtroopers to their hiding spots in the nearby mines of Novohrodivka. These positions are then subjected to precise artillery strikes, coordinated with reconnaissance drones.

In one striking instance, a single accurate artillery round demolished an entire building filled with Russian soldiers, underscoring the precision of Ukrainian artillery, and its critical role in neutralizing Russian assault units, before they can even launch an attack.

Despite the losses, due to their hurry to achieve strategic results during winter, the Russian command opts to proceed with assaults on the Ukrainian positions near Myrnograd. Combat footage from the area reveals Ukrainian drone strikes on Russian forces trying to establish positions in trenches.

Notably, large Russian assault groups of up to 20 soldiers break up in panic and disorganization, after Ukrainian drone strikes start, canceling their assault as a whole. Most Russian soldiers are tracked and eliminated in trenches and dugouts, one by one, so that Ukrainian soldiers can physically retake positions afterward. The relentless casualties are taking a devastating toll on Russian morale.

Disturbingly, combat footage has emerged showing soldiers, overcome by despair and a sense of impending death, wandering into local cemeteries to sit and await the inevitable strike from Ukrainian drones.

This harrowing phenomenon highlights the profound psychological strain on Russian forces, many of whom perceive their survival as hopeless in such dire conditions. Reports suggest that the life expectancy for Russian soldiers on the frontlines has plummeted to just two weeks, with marginally better prospects - around four weeks - in quieter sectors.

These grim statistics are particularly stark among volunteer recruits, who often lack sufficient training and equipment to survive in such a brutal environment. This rapid turnover of poorly prepared reinforcements is not only eroding Russia’s manpower reserves, but also severely compromising its ability to sustain prolonged military operations.

Overall, the catastrophic attrition of Russian forces near Myrnohrad underscores the broader operational inefficiencies and strategic desperation of the Russian military. The decision to press relentless assaults, despite minimal tactical gains and devastating losses, reflects a leadership more focused on achieving symbolic deadlines than on sustainable military planning.

The alarming 2-week life expectancy for Russian soldiers not only highlights the human cost of this approach but also suggests an accelerating depletion of manpower that will have cascading effects on their ability to maintain offensives elsewhere.


9,077 posted on 12/04/2024 6:11:25 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9075 | View Replies]

To: AdmSmith

For a supposedly Christina nation, suicide is a mortal sin. This must place many in a real quandary that their leadership would suggest committing a mortal sin in the name of the Motherland.


9,078 posted on 12/04/2024 6:13:22 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9076 | View Replies]

To: PIF

Christina = Christian


9,079 posted on 12/04/2024 6:14:08 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9078 | View Replies]

To: PIF
FTA: ...These positions are then subjected to precise artillery strikes, coordinated with reconnaissance drones.

UKF are clearly winning the "drone" war (ISR & FPV).

The entire article explains the daily high number of KIA/WIA.

Thanks for posting.

9,080 posted on 12/04/2024 6:57:11 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9077 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,041-9,0609,061-9,0809,081-9,100 ... 22,561-22,564 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson