Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,161-8,1808,181-8,2008,201-8,220 ... 19,421-19,426 next last
To: marcusmaximus

There have been attacks on missile production facilities in both Russia and Iran, that may have disrupted re-supply to Russian forces.


8,181 posted on 11/11/2024 4:25:59 PM PST by BeauBo
[ Post Reply | Private Reply | To 8180 | View Replies]

To: marcusmaximus

There have been attacks on missile production facilities in both Russia and Iran, that may have disrupted re-supply to Russian forces.


8,182 posted on 11/11/2024 4:25:59 PM PST by BeauBo
[ Post Reply | Private Reply | To 8180 | View Replies]

To: AdmSmith

Nationalize much? Or just follow the Fascist model of titular private ownership, with overriding Government control...

MSN reports:

“Russia is considering a plan to combine three of its oil giants, making for the world’s second-largest largest oil producer, The Wall Street Journal reported.

The deal would involve state-backed Rosneft Oil taking over state-owned Gazprom Neft (a subsidiary of Gazprom) and the independently-run Lukoil, the Journal report said.” (Company spokesman denied the report)


8,183 posted on 11/11/2024 5:44:55 PM PST by BeauBo
[ Post Reply | Private Reply | To 8160 | View Replies]

To: PIF; AdmSmith; SpeedyInTexas; blitz128; FtrPilot; BeauBo; UMCRevMom@aol.com; MalPearce; BroJoeK

To several Ukraine stalwarts: Report from Kremlin Snuff Box (secrets): Interesting the line in #8162 saying that people around Trump are saying Russia will not be keeping Crimea. Also connecting the Kursk occupation vs the 4 east Ukraine oblasts in future negotiations.

Thinking about Trump and Crimea. I know Trump was wanting to build a hotel in Russia. I also read that Trump’s sons were trying to put together a deal with Erdowan’s relatives (sons-in-law?) to build big in Turkey. Since there were perhaps 20% Turkish ethnics in Crimea when Putin moved in in 2014, Erdowan probably had significant interest in his discussions with Zelensky, and at the time it sounded as if something positive had happened.

In 2012 Ukraine had signed exploration contracts with 2 US oil majors (anyone know which companies?) to seek oil in the Black Sea around Crimea. In 2014 Putin made those contracts null and void. I am sure those companies will want to renew those contracts, and have supporters in Congress and will also have them among the oil lovers that support Trump. All in all helping Ukraine keep Crimea sounds likely in a Trump Admin. A Moscow hotel would not be politically wise at this time. Something to do in his old age in 2028 makes more sense. Probably more money to be made with Turkey anyway. Protecting the export lanes for Ukraine wheat to the second and third world will make more friends for the Trump Admin. too.


8,184 posted on 11/11/2024 5:50:30 PM PST by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 8162 | View Replies]

To: JonPreston
Ukraine on the brink of military disaster, says veteran

https://www.msn.com/en-us/news/world/ukraine-on-the-brink-of-military-disaster-says-veteran/ar-AA1tSFEf?ocid=msedgdhp&pc=ASTS&cvid=b0b9ff74438640dfb58a2bd5d66790a3&ei=13

The New Voice of Ukraine

“There are no reserves because, here in the rear, we’re failing mobilization. This is the military’s problem, but not one created by the army,” Dykyi explained.

He described the current situation as he sees it:

“We here in the rear aren’t providing reinforcements to the military, and then we ask, ‘Army, why can’t you hold the front?’ And the army simply answers: ‘With what? Who will hold it? Hey, rear, where are the people?’ And the rear says, ‘Well, people are busy, people are sitting in cafes, they have a lot of other things to do. Yeah, hey army, why aren’t you holding the front?’”

8,185 posted on 11/11/2024 6:07:52 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8165 | View Replies]

To: BeauBo

According to jonboy it’s Ukraine falling apart lol


8,186 posted on 11/11/2024 6:29:41 PM PST by blitz128
[ Post Reply | Private Reply | To 8183 | View Replies]

To: gleeaikin

I like your thinking.

Crimea is a pot of gold, with all the oil and gas offshore. The EU should be fighting for it, for their own energy security.


8,187 posted on 11/11/2024 7:54:47 PM PST by BeauBo
[ Post Reply | Private Reply | To 8184 | View Replies]

To: blitz128

lol


8,188 posted on 11/11/2024 7:56:31 PM PST by BeauBo
[ Post Reply | Private Reply | To 8186 | View Replies]

Russian Offensive Campaign Assessment, November 11, 2024

Russian regional governments continue to commit large portions of their social budgets towards payments to Russian veterans, likely as part of ongoing efforts to incentivize Russian military service. Russian opposition outlet Vazhnye Istorii (iStories) reported on November 11 that Stavropol Krai is spending 83 percent of its social budgets on payments to Russian veterans and that Russian regions are spending on average 13 percent of their budgets on one-time payments to contract servicemembers (kontraktniki).[80] iStories reported that one-time payments to veterans and the families of deceased servicemembers have reached or exceeded a quarter of the entire budget for 35 percent of all Russian regions.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-november-11-2024


8,189 posted on 11/11/2024 10:24:25 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8152 | View Replies]

New record 1 950 or 1.35/min. How many Norks?


8,190 posted on 11/11/2024 11:24:34 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8153 | View Replies]

To: AdmSmith

“one-time payments to veterans and the families of deceased servicemembers”

That is what they are calling “GDP”.

“New record 1,950 (Russian casualties in a day), or 1.35/min”

That, they are calling GDP growth.

In reality, it is a giant bonfire of Russia’s wealth and human capital.

All because of Vlad, the disaster.


8,191 posted on 11/12/2024 2:42:12 AM PST by BeauBo
[ Post Reply | Private Reply | To 8189 | View Replies]

To: BeauBo

Not sure about all the fronts, but I would say Kursk is responsible for a large part of these losses
The way the Russians disregard the Kursk operation from the beginning reminds me of many of the claims that have been made over the nearly 3 years

Putin went in easy.
Putin does not want to destroy Ukraine
Russia has huge reserves being held back
Russia will never run out of ammunition and equipment and manpower
Europe will freeze
Sanctions have had no effect
Economy great, GDP great
Kursk is a distraction and will have no effect on the war….


8,192 posted on 11/12/2024 4:14:29 AM PST by blitz128
[ Post Reply | Private Reply | To 8191 | View Replies]

To: blitz128

You should add to that list the FSB talking point that Russia is no longer communist or authoritarian.

I reality their semi-flat tax is gone, Stalin is being rehabilitated, they seek Soviet style domination over neighboring republics, and they hand out 15-year sentences for dissent.


8,193 posted on 11/12/2024 4:22:23 AM PST by Monterrosa-24 (Saludemos la patria orgullosos)
[ Post Reply | Private Reply | To 8192 | View Replies]

To: BeauBo

Putin has given many reasons for his invasion, Nazis, protection from nato, historical claims…., but the real reasons IMO get little attention
Of course having his warm water port was one, and his general belief in the greater historical Russia is another, but less talked about are the resources in the area. Oil, gas, coal, and agriculture are the biggest reason, the rest was mostly cover(though the idea that Ukraine is not part of Russia does bother Putin deeply), but not just the economic side of these resources, but the control of them esp. the agricultural side.

Controlling vast amounts of natural resources, including food would give him the clout and power he desires


8,194 posted on 11/12/2024 4:29:12 AM PST by blitz128
[ Post Reply | Private Reply | To 8187 | View Replies]

To: Monterrosa-24

Good point, Russia has never really strayed far from their soviet behaviors and beliefs
Top on this list is the idea that Russia is some kind of democracy and Putin is not a dictator.

I have often asked what does it mean to be a nazi or fascist in these days.
The reality is that there was little difference between nazi germany and the Soviet Union.

Both were fascist, both were dictatorships, both had strong internal security apparatus to control the populations, both controlled the media and the economy, and Putin grew up and worked as a KGB agent within those parameters.

Putin has written and spoken of how he laments the end of those times, and for what little change happened after 1991, Putin has worked to undo those changes and re-create the Soviet Union in power and prestige.

If one was to compare how Ukraine operates these days and how Russia does, which more closely resembles how Nazi germany and stalins Soviet Union did.

I think the answer is clear, Russia may not call themselves nazis, but they operate like they did.


8,195 posted on 11/12/2024 4:39:34 AM PST by blitz128
[ Post Reply | Private Reply | To 8193 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Kim Jong-Un Embarrassed. Assault Units Demolished Within Minutes! ]


Today [ Nov 12 ], there are a lot of interesting updates from the Kursk direction.

After over a month of preparations, the Russians initiated a new wave of counterattacks to recapture Malaya Loknya from 2 axis of advance with the engagement of North Koreans.

However, Ukrainians took advantage of the operational pause, enabling them to fully prepare some of their most elite units to face the Russian assaults.

The Russian plan in this area was to advance 4 km along a paved road toward Malaya Loknya aiming for the town near the settlement of Pogrebki. A second route was planned to the west of Malaya Loknya, advancing via the road from Novoivanovka.

Gaining control of Malaya Loknya would allow the Russians to cut off Ukrainian forces position north of the town and secure a large northern area, thereby extending their counter offensive southward toward Sudja

Some of Ukraine’s most elite and experienced units, including the 47th Mechanized Brigade 82nd airmobile Brigade 17th Mechanized Brigade and 80th Airmobile Brigade, were tasked with defend in this area. Given these units expertise and strong leadership, they anticipated repeated large-scale Russian mechanized assaults along the paved roads to Malaya Loknya.

Recognizing that the Russians could only attack from 2 directions, due to the limited road access, Ukrainian commanders prepared by deploying substantial drone units and implementing remote mining along these roads to counter the assault.

As anticipated, the Russians launched a major assault north of Pogrebki, along the road to Malaya Loa, deploying around 15 BTRs and over 150 soldiers from the Russian 810th Marine Brigade, reportedly with North Korean troops.

The assault hit landmines immediately, wiping out the first 3 vehicles and an entire platoon before reaching Ukrainian controlled areas. By the time Russian forces entered Pogrebki 5 of the 15 BTRs had already been destroyed destroyed by landmines alone.

Ukrainians then destroyed 9 more BTRs around Pogrebki, using a combination of drones, landmines, and RPGs, forcing a desperate Russian retreat. Only 1 BTR managed to reach the rear, but was soon eliminated, marking the total destruction of the Russian column.

Published footage by the Ukrainian troops from the area, reveals that North Korean Type 73 machine guns were discovered scattered around the eliminated column. This implies the gradual inclusion of North Korean soldiers in Russian storming operations, as their number of deployed fighters are slowly growing in Kursk

Anticipating a coordinated Russian assault from Novoivanovka to align with the attack toward Pogrebki, Ukrainians deploy tanks from the 17th Mechanized Brigade to disrupt Russian force concentrations preparing for the offensive.

Combat footage shows Ukrainian tanks conducting a raid on Russian positions in nearby forests, after effectively neutralizing these assault forces and eliminating the threat, the Ukrainian tanks withdrew without incurring any losses

Overall, the Russians launched their largest assault in the direction of Malaya Loknya, in hopes of repeating the success of their previous operations in Kursk and failed, as their entire assault units were wiped out

As the intensity of Russian attacks in Kursk are growing with a relatively low number of troops for broader offensive operations, they are hurrying up to include North Korean troops in their further offensive efforts, however with disastrous efficiency so far.


8,196 posted on 11/12/2024 4:43:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8191 | View Replies]

To: blitz128

Controlling vast amounts of natural resources, including food would give him the clout and power he desires


Conversely, Russia already controls even vaster natural resources. However, the difference is the resources in Ukraine are developed and easy to get and use, relative to those much greater resources in Central and Far Eastern Russia.


8,197 posted on 11/12/2024 4:48:31 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8194 | View Replies]

To: PIF
A Russian tank with ammunition inside exploded after it was reportedly hit by an FPV of the 10th Mountain Assault Brigade in the Siversk direction.

https://x.com/NOELreports/status/1856314543950930110


8,198 posted on 11/12/2024 5:08:13 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8179 | View Replies]

To: PIF

Agreed but it is not the amount that Ukraine has that matters as much as it is the total of both countries

Remember all the stories of food crisis when Ukraine could not export grains…. at the levels they were?

Controlling both Russias and Ukraines resources esp on grain side would give him great powers of extortion, add the other natural resources and his power is even greater

However the war cannot end as a frozen conflict as it stands now, Putin cannot accept Ukraine controlling parts of Kursk and much of what Russia has claimed with their “referendums” is not under their actual control

Not sure how Putin could polish that turd and still survive after all the blood, treasure, and promises.


8,199 posted on 11/12/2024 5:09:13 AM PST by blitz128
[ Post Reply | Private Reply | To 8197 | View Replies]

To: All

8,200 posted on 11/12/2024 5:13:45 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8198 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,161-8,1808,181-8,2008,201-8,220 ... 19,421-19,426 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson