Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,841-16,86016,861-16,88016,881-16,900 ... 22,521-22,528 next last
To: FtrPilot; BeauBo; blitz128; PIF
More BAD news for Russia, as official government statistics agency Rosstat reports catastrophic losses across the entire corporate sectors of oil, gas & mining for Feb and March.

Highlights:

February 2025
Mining: -61%
Oil/Gas: -73%

March 2025
Mining: -89%
Oil/Gas: -106%

https://bsky.app/profile/evgen-istrebin.bsky.social/post/3lqzibzjtas23

16,861 posted on 06/07/2025 11:25:21 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16817 | View Replies]

When lunch catches itself 👀

https://bsky.app/profile/united24media.com/post/3lqzwydzxmx2w

12 s video


16,862 posted on 06/07/2025 11:32:15 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16861 | View Replies]

To: BeauBo; blitz128; FtrPilot
Day 1,200 of the Muscovian invasion. 1,120 [average is 830/day], i.e. more than 46 Russians and Norks/h. Vehicles and fuel tanks more than 240% and artillery more than 70% above average. 1 plane (Su-35). Motorcycles are not counted yet.



3,850 to go to a million. Will it be on Thursday (Russia Day)?

https://en.wikipedia.org/wiki/Russia_Day
16,863 posted on 06/08/2025 1:00:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16776 | View Replies]

To: AdmSmith; FtrPilot; blitz128

Anders Puck Nielsen (NATO analyst on YouTube), projects the Air War to intensify this year, as both sides surge strike capabilty (drone and missile), increasingly overwhelming Air Defense.


16,864 posted on 06/08/2025 1:42:02 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16860 | View Replies]

To: AdmSmith

“Rosstat reports catastrophic losses across the entire corporate sectors of oil, gas & mining for Feb and March”

Let there be rubles!

A geyser of newly printed rubles will need to erupt this year, and lagging a few months later, the resulting inflation.

Russia can’t make money in business anymore, so they will have to make it at the Central Bank.

It is going to be hard to manage, without a hard landing.


16,865 posted on 06/08/2025 1:51:33 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16861 | View Replies]

To: BeauBo
Let there be rubbles!
16,866 posted on 06/08/2025 2:04:47 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16865 | View Replies]

To: AdmSmith
Britain has gone full retard


16,867 posted on 06/08/2025 3:04:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16863 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russia’s Key Munitions Network Shattered! ]

Today [ June 7 ], there are a lot of interesting updates from the Russian Federation. Here, Ukrainian forces have begun targeting not just the Russian military equipment, but the factories that produce them - deep in the industrial core of the country. By striking key munitions plants responsible for explosives, bomb kits, and artillery components, they’ve set off a chain reaction that could choke Russia’s ability to sustain its summer offensive.

The goal of the Ukrainians here is to prevent the Russians from rebuilding their ammunition stockpiles after the latest destruction of the large Grau artillery arsenal in Vladimir Oblast. The success of this attack led to the destruction of up to 264,000 tons of drone, artillery, and missile stockpiles, equating to at least half a year of Russian munitions production.

To prevent Russians from rebuilding these stockpiles, Ukrainians commenced a devastating series of precision drone strikes, starting with strikes on the Bazalt military-industrial complex in Moscow. Satellite images confirm the strike, a direct hit on the center of the main building, which was already targeted by Ukrainian drones in the past. Bazalt is a key Russian defense enterprise, specializing in the design, development, and production of a wide range of munitions for the entire Russian army.

Most notably, this plant produces high-explosive and thermobaric FAB glide bombs, which are equipped with guidance kits that are used for frontline and rear strikes by the Russian Air Force. The disruption of the production of guided bombs at this plant will have a massive effect on the Russian summer offensive, as Russian assault tactics are heavily dependent on glide bomb strikes to destroy detected Ukrainian positions.

Additionally, Ukrainian drones attacked the Murom Instrumentation Plant in the Vladimir region, 670 kilometers away from the front. The attack resulted in devastating fire that engulfed the warehouse storing finished materials, while damaging the factory administration building, and a factory building where explosives are synthesized got severely damaged.

Notably, the electronic warfare systems in place at the factory were completely ineffective at repelling the drone strike, indicating that Ukraine is implementing AI targeting software more widely in its long-range strike drones as well. The plant is known in Russia for producing explosive ignition systems, including caps and primers for various types of ammunition used by the Russian military.

Subsequently, the Ukrainians struck the Sverdlov State Enterprise in Dzerzhinsk, nearly 800 kilometers from the frontline, one of the most critical Russian military industrial plants. The plant was already struck in the past year due to its immense strategic significance, as it is the sole producer of high explosives hexogen and octogen, which are essential to produce artillery shells, ballistic missiles, anti-tank guided missiles, glide bombs, and air defense missiles.

At last, the final target of Ukrainian strikes was the Azot chemical plant in Novomoskovsk in the Tula region, 350 kilometers from the front, causing a massive fire that left a significant part of the factory badly damaged. The chemicals produced at Azot, ammonium nitrate, methanol, and argon, are key components in explosives, the production of rocket fuel, welding, and heat treatment of metals used in Russian weapon systems.

The Murom Instrument-Making Plant, NPO Bazalt, Azot Tula Plant and the Sverdlov Plant form a critical link in Russia’s munitions supply chain, producing fuzes, warheads, hard materials, and explosive compounds. Together, they enable the mass production of artillery shells, guided bombs, and missiles heavily used in Russia’s war on Ukraine, and critical for the Russian summer offensive to succeed.

Continued disruption of these facilities, all of which have already been targeted by Ukrainian drones and missiles in the past, will significantly impair Russia’s ability to sustain high-intensity combat operations.

Overall, the Ukrainians conducted precision strikes at most critical parts of the Russian military industrial complex, responsible for producing essential materials for nearly all Russian equipment - ranging from artillery to aerial bombs. Such major sabotages can create prolonged and devastating shortages of ammunition and supplies to frontline units, slowing down Russian offensive efforts as they take months to rebuild.

Ammunition shortages force the Russians to slow down their attacks and fire at lower rates, making breakthroughs more difficult, and allowing the Ukrainians to better sustain the pressure; which is of immeasurable value with the Russians going all-in for their summer offensive.

https://www.youtube.com/watch?v=XJEEhQNpcMY


16,868 posted on 06/08/2025 4:44:52 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16866 | View Replies]

To: BeauBo
Ukraine seems to have launched another hidden drone ambush: this time from train wagons. Reportedly, more than 100 armored vehicles were burned [SBU, June 2025]



Now they will be searching every train, every railroad car in all of Russia ... then consider Russian military logistics move by train. Backups with trucks - pift, a mere scratch compared to rail back up.
16,869 posted on 06/08/2025 4:59:24 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16865 | View Replies]

To: FtrPilot
quoting: "This, despite Kazakhstan’s membership in the Russia-led CSTO."

FtrPilot: "I wonder what Kazakhstan's long term goal is."

In 1994, all CSTO members, including Russia and Belarus, joined NATO's Partnership for Peace, with the obvious intent of maintaining good relations & peace with all countries.

Today, CSTO members Kazakhstan, Armenia, Kyrgyzstan & Tajikistan are still NATO Partners for Peace, doubtless for the same reasons they first joined in 1994.

16,870 posted on 06/08/2025 5:39:14 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 16789 | View Replies]

To: AdmSmith; FtrPilot
"The russians have begun moving Tu-160 bombers to Anadyr Anoat, 4,000 miles from Ukraine and just 400 miles from..."

Anoat, on the Star Wars outer rim, once a city-world, now highly polluted:

16,871 posted on 06/08/2025 5:58:00 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 16792 | View Replies]

To: gleeaikin; FtrPilot; BeauBo; PIF
gleeaikin: "Given the fate and experience of original CSTO member like Belarus and Armenia, it is obvious that CSTO membership is not a secure defense against Russia/Putin."

People forget that in 1994, CSTO and NATO membership were not considered mutually exclusive, and so every CSTO member also joined NATO's Partnership for Peace.
Today, Russia & Belarus have been expelled from NATO, but four other countries maintain their dual membership:

  1. Kazakhstan
  2. Armenia
  3. Kyrgyzstan
  4. Tajikistan
This map is out of date, showing Russia, Belarus, Finland & Sweden as PfP members, which none are today.
Russia & Belarus are suspended from NATO's Partnership for Peace.
Finland & Sweden have become full NATO Article 5 members:


16,872 posted on 06/08/2025 6:34:49 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 16805 | View Replies]

To: FtrPilot
Reagan's actual quote is very close to that. It's curious how much the world has changed since 1983, and how much it has not.
16,873 posted on 06/08/2025 6:50:08 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 16803 | View Replies]

To: BroJoeK

Our message must be: Your struggle is our struggle, your dream is our dream, and someday, you, too, will be free.”

Curious too, is how some posters on this thread try everything to nullify that message, to even posting it upside down, signalling distress and disapproval.


16,874 posted on 06/08/2025 8:12:10 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16873 | View Replies]

To: PIF
A thunderstorm in Moscow. Lightning hit Ostankino TV tower.

https://bsky.app/profile/antongerashchenko.bsky.social/post/3lr3q2wlxzk2f

5 s video

Since Muscovites are superstitious, they will interpret a lot into this.

16,875 posted on 06/08/2025 9:12:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16874 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...
Back in 1999, Putin insisted Russia doesn't want Crimea and warned that redrawing international borders would be a disaster.

https://bsky.app/profile/antongerashchenko.bsky.social/post/3lr43kfwomk2f

1 m video Eng sub

Press Statement and Answers to Questions at a Joint News Conference with Ukrainian President Leonid Kuchma May 17, 200200:01Bocharov Ruchei, Sochi

Question: Is Russia going to join NATO? What major changes do you foresee in the relations between Ukraine and NATO? And how do you see the pattern of Ukraine-Russia-NATO relations in the future?

Vladimir Putin: Russia does not intend to join NATO. Russia, as you know, is engaged in a very constructive dialogue with NATO to create a new Russia-NATO structure “at twenty”, in which all twenty countries will be represented as nations, each having one vote, and all the issues will be solved without prior consultations, without any prior decisions on a number of issues being taken first within the bloc. You know about these issues and practical consultations have already been completed. These issues are terrorism, humanitarian operations, the non-proliferation of weapons of mass destruction and other issues.

I am absolutely convinced that Ukraine will not shy away from the processes of expanding interaction with NATO and the Western allies as a whole. Ukraine has its own relations with NATO; there is the Ukraine-NATO Council. At the end of the day the decision is to be taken by NATO and Ukraine. It is a matter for those two partners

http://en.kremlin.ru/events/president/transcripts/21598

16,876 posted on 06/08/2025 9:22:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16875 | View Replies]

To: AdmSmith

1999

That was back when the real Putin was still alive. The Putin double is out of control.


16,877 posted on 06/08/2025 9:57:09 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16876 | View Replies]

To: PIF; BeauBo; BroJoeK; FtrPilot; SunkenCiv; marcusmaximus

It did not take long for Alexander Dugin to get his hooks into Putin, with the ideas in his 1997 book “Foundations of Geopolitics”. Dugen soon became know to the Russian people by the name “Putin’s Brain”:

https://en.wikipedia.org/wiki/Foundations_of_Geopolitics

When you read the 20+ bullet points in this review, it becomes clearer where some of Putin’s plans are coming from, especially regarding the political and social troubles we have had in the US. See how many of these points you can recognize from your knowledge of recent history. Putin has ordered this book used in all military schools, and would like to put it in all high schools. Most recently Dugin has advised Putin on means for increasing the Russian birth rate (for cannon fodder) and alcoholism (for sober soldiers).


16,878 posted on 06/08/2025 10:27:16 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16877 | View Replies]

To: PIF; BroJoeK
"That was back when the real Putin was still alive. The Putin double is out of control."


16,879 posted on 06/08/2025 10:32:04 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16877 | View Replies]

To: BroJoeK; PIF; FtrPilot
Reagan's actual quote is very close to that.

Thats why I post the picture upside down; the quote is a lie

16,880 posted on 06/08/2025 10:34:45 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16873 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,841-16,86016,861-16,88016,881-16,900 ... 22,521-22,528 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson