Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,141-16,16016,161-16,18016,181-16,200 ... 21,461-21,462 next last
To: BeauBo
Day 1,186 of the Muscovian invasion. 1,020 [average is 826/day], i.e. more than 42 Russians and Norks/h. Vehicles and fuel tanks more than 165% and artillery more than 185% above average. Motorcycles are not counted yet.


16,161 posted on 05/25/2025 4:52:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16111 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

Russia begins to open another front in its war on the West

[ From Threats to Attacks! Ship captured, Borders Redrawn! Estonia Braces And Digs In! ]

Today [ May 24 ], there is interesting news from the Baltic states. Here, the escalation between Russian and Estonia continue to spiral out control, as Russian forces detained a ship with Estonian cargo a few kilometers from the shore. As the hybrid attacks on Estonia are only increasing, the country launched a massive defense revamp campaign, conducted the largest joint military training with NATO allies, and even started considering the creation of extensive minefields along the Russian border.

Recently, tensions have escalated significantly after Russian authorities detained the Green Admire, a Greek-owned, Liberia-flagged oil tanker, that had just departed from Estonia’s Sillamae port. The vessel was en route to Rotterdam, carrying shale oil when it passed through Russian waters, part of a mutually agreed-upon safe maritime corridor shared by Russia, Estonia, and Finland. Despite adhering to this protocol, Russia intercepted the ship and towed it to port to impose a fine.

The Estonian Foreign Ministry called the detention a violation of maritime norms, and has since announced it will reroute all naval traffic exclusively through Estonian territorial waters. The Estonian Foreign Minister Margus Tsahkna, commented that this incident shows that Russia continues to behave unpredictably. This follows the recent Russian airspace violation as the Estonian navy attempted to intercept an oil tanker part of the Russian shadow fleet.

This incident is just the latest in a long list of Russian provocations directed at Estonia. Only last year, Russia published a draft resolution indicating plans to unilaterally redraw maritime borders in the Gulf of Finland, effectively claiming parts of Finnish and Latvian waters, before quietly withdrawing the threat without explanation. Adding to the friction, Russian border guards removed more than half of the buoys marking the Estonia-Russia border on the Narva River.

Despite repeated Estonian diplomatic requests, the markers have not been returned, leaving river traffic vulnerable to accidental border violations. Meanwhile, GPS jamming, believed to originate from Kaliningrad, has caused hundreds of aviation disruptions in the region’s aerospace. In 2023 alone, Estonian authorities received 307 reports of interference, 85% of which were GPS-related. Though air traffic remains safe thanks to manual navigation practices, the disruptions underscore a deliberate Russian effort to sow instability.

In response to these hybrid threats, Estonia has embarked on a major defensive initiative. Estonia’s Center for Defense Investments is launching the construction of 600 concrete bunkers along the Russian border, which represents a significant shift in national defense thinking. Designed to withstand 152mm artillery fire, the Soviet-era munition standard that Russia continues using for its tube artillery.

Previously tested prototypes are being refined, and sample installations will begin in southern and northeastern Estonia by fall. Estonian Defense Forces officials emphasized the importance of completing as much of the work as possible during peacetime with civilian equipment. The bunkers will be concealed as mounds and monitored regularly for readiness. In parallel, Estonia has acquired concrete dragon’s teeth and barbed wire valued at 1.6 million Euros, although these will only be installed if tensions escalate further.

Following the lead of Lithuania and Poland, Estonia is also considering withdrawing from the Ottawa Convention on anti-personnel mines. The war in Ukraine has demonstrated their continued effectiveness in halting enemy advances, and Estonia believes maintaining this option is vital to defending its borders.

Military readiness has also been boosted through large-scale exercises. Earlier this month, Estonia hosted Exercise Hedgehog 2025, its largest annual military drill. Involving over 16,000 troops from 10 NATO countries, the exercise simulated a full-scale Russian incursion. It tested rapid response strategies and interoperability among allied forces.

Estonia’s new doctrine now prioritizes defending territory from the first moment of attack, moving away from the older “tripwire” strategy that assumed an initial enemy advance before a NATO counteroffensive. The lessons from Ukraine, especially Russia’s destructive tactics and the steep cost of reclaiming lost land, have fundamentally reshaped Estonia’s defense posture.

Overall, as Russian provocations continue, a strong Baltic line of defense is taking shape. Estonia, Lithuania, Latvia, and Poland are fortifying their borders, building bunkers, strengthening infrastructure, and enhancing military readiness with NATO’s backing. Their geography makes them vulnerable, but the Baltic states no longer want to be passive observers. They’re forming a collective wall of resistance, ensuring that any further Russian provocations will be met with a harsher and immediate response, improving their strength and deterrence ability

https://www.youtube.com/watch?v=NAdJBW6p_do


16,162 posted on 05/25/2025 5:46:52 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16161 | View Replies]

To: PIF
😎🔥 Destruction of Buk SAM launchers and radars by Ukrainian drone operators of the 413th Reid Battalion.

https://x.com/Maks_NAFO_FELLA/status/1926570643589317023


16,163 posted on 05/25/2025 6:09:50 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 16162 | View Replies]

To: FtrPilot

War is about adaptation, measures bring counter measures which bring counter counter measures…..

As I recall there were issues with jamming of certain systems early on and that appears to have been corrected for now, same will be with patriot

Apparently the Russian counter measures for drones on systems designed to shoot down drones still need some work 😂


16,164 posted on 05/25/2025 6:17:41 AM PDT by blitz128
[ Post Reply | Private Reply | To 16163 | View Replies]

To: AdmSmith

Another day, more than a thousand more Russian casualties sacrificed on the altar of Putin’s greed and lust for power.

Marching like lemmings toward a million.


16,165 posted on 05/25/2025 6:25:51 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16161 | View Replies]

To: AdmSmith

“Russian forces appear to be increasing their use of long-range drones and decreasing their use of cruise missiles”

Perhaps for the same reason that they are decreasing their use of tanks, and increasing their use of motorcycles and the Lada Rollabout.


16,166 posted on 05/25/2025 6:29:59 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16159 | View Replies]

To: marcusmaximus

“Air travel in Russia is imploding”

Oops - Exploding.

Well both really.


16,167 posted on 05/25/2025 6:37:35 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16158 | View Replies]

To: FtrPilot
Whoa … what was that at the end of the video?

Looked like the drone was moving slowly, coming in to investigate, but then got hit and destroyed by something just before the drone got to whatever that is on the end of the boom.

16,168 posted on 05/25/2025 7:45:52 AM PDT by GBA (Endeavor to persevere. Onward through the fog …)
[ Post Reply | Private Reply | To 16163 | View Replies]

To: blitz128; FtrPilot

FYSA, from Ukrinform:

“The Netherlands will complete the delivery of its pledged F-16 fighter jets to Ukraine on Monday, marking the transfer of the final aircraft from a total of 24.
Dutch Defense Minister Ruben Brekelmans said this during the WNL op Zondag television program, Ukrinform reports, citing Hart van Nederland.

“The Netherlands will send its last F-16 fighter jet to Ukraine on Monday,” Brekelmans said.

This means that all 24 promised Dutch F-16s will be sent to Ukraine, the minister said.

In February 2025, Ukraine’s Air Force received (a batch of) F-16s from the Netherlands and the first Mirage 2000 fighter jets from France. Ukraine began receiving the F-16s from the Netherlands in October 2024


16,169 posted on 05/25/2025 8:30:55 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16164 | View Replies]

To: BeauBo; AdmSmith; PIF; blitz128; idiot
assembled by me on 5/24/25

Senior Russian officials continue to deny the legitimacy of the Ukrainian president, government, and constitution and Ukraine’s sovereignty despite Russian President Vladimir Putin’s recent efforts to feign interest in peace negotiations to end the war. Russian Security Council Secretary Dmitry Medvedev claimed during the St. Petersburg International Legal Forum on May 20 that there are currently no Ukrainian officials with the authority to conclude a peace treaty with Russia and that Russia may need to consult Ukraine’s Constitution to identify authorized negotiation partners.[1] Medvedev questioned Ukraine’s sovereignty and claimed that Ukraine is a “failed state” whose leaders’ lack of legitimacy raises “serious questions” about who Russia can negotiate with during future peace negotiations.[2] Medvedev‘s claims directly contradict Putin’s reported agreement with US President Donald Trump to immediately begin bilateral negotiations with Ukraine.[3] Medvedev’s statements indicate that Russia is, in fact, not interested in engaging with Ukrainian President Volodymyr Zelensky and other senior Ukrainian government officials who are key to bilateral negotiations to end the war.

Russian officials have repeatedly promoted the false narrative that Zelensky and the Ukrainian government are illegitimate to justify Russia’s refusal to engage in good-faith negotiations with Ukraine and further Russia’s long-standing war goal of establishing a pro-Russian puppet government in Kyiv.[4] Ukraine’s Constitution and Ukrainian law explicitly state that Ukraine cannot hold elections while martial law is in place and that Ukrainian authorities cannot lift martial law while “the threat of attack or danger to the state independence of Ukraine and its territorial integrity” remains.[5] Zelensky also recently clarified that a September 2022 presidential decree does not preclude him from negotiating with Putin.[6] Chairperson of Ukraine’s Verkhovna Rada Foreign Affairs Committee Oleksandr Merezhko recently stated that Ukraine’s Constitution “clearly” specifies Zelensky as Ukraine’s chief negotiator and noted that Zelensky’s constitutional powers allow him to override past decrees.[7] ISW continues to assess that any long-term peace agreement between Russia and Ukraine must include Russia’s explicit recognition of the legitimacy of the Ukrainian president, government, and the Ukrainian Constitution.[8]

Ukraine’s Western allies continue to provide military aid to Ukraine and support Ukraine’s defense industry. Italian media reported in mid-May 2025 that Italian Defense Minister Guido Crosetto announced that Italy approved an eleventh military aid package for Ukraine, which will include one SAMP/T air and missile defense system, 400 M-113 armored personnel carriers, and ammunition.[14] Ukrainian state-owned defense enterprise manager Ukroboronprom reported on May 20 that it signed a memorandum of cooperation with Belgian ammunition manufacturer KNDS Belgium to coordinate the joint assembly of medium-caliber ammunition for automatic cannons.[15]

The European Union (EU) and the United Kingdom (UK) announced several sanctions packages against Russia on May 20.[16] The package is the EU’s largest targeting Russia’s shadow fleet and the Russian energy and military-industrial sector.[17] The EU also sanctioned the Russian Radiological, Chemical, and Biological Defense Troops; the 27th Scientific Center; and the Russian Ministry of Defense’s 33rd Central Scientific Research and Testing Institute for Russia’s use of chemical weapons in Ukraine.[18] The UK also announced new sanctions against Russia’s military, energy, and financial sectors on May 20.[19]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-20-2025

16,170 posted on 05/25/2025 9:29:02 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16169 | View Replies]

desolved?

As much as pitin “loves his history”,Russian mir cares not for anything but their version. So I stand by the idea that pitin rejects that the Soviet union was actually desolved.

Perhaps pitin should go back far enough and decide that Russia still belongs to the Mongolians 😎🤔

16,132 posted on 05/24/2025 8:36:16 AM PDT by blitz128

16,171 posted on 05/25/2025 9:32:49 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16170 | View Replies]

Assassination attempt by Zelensky

‼🇷🇺 Failed assassination attempt on Russian President Putin.

The helicopter carrying the president became the target of a Ukrainian drone attack during his visit to the Kursk region.

The AD commander of the region reports that all drones were destroyed while providing cover… pic.twitter.com/sLgbAfSq8H— Spetsnaℤ 007 🇷🇺 (@Alex_Oloyede2) May 25, 2025


16,172 posted on 05/25/2025 10:22:24 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16131 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...
Dmitry Medvedev
24MAY2025 Doomsday Radio Station: May's “good-naturedness” has been replaced by a fierce “grunt”

After massive drone raids on our country and its capital on the eve of Victory Day to intimidate foreign guests, there is a deathly silence in European centers. Pediculotic pigs who hide suspicious napkins and spoons on trains only grunt blissfully with pleasure.

After 500 drones launched at civilian targets in Russia in recent days to intimidate our people, there is the same silence. The stinking hogs who bred a horde of Bandera nits on the body of typhus-ridden Europe are lazily scratching themselves.

Now the same greasy pigs in Paris, Berlin and London will raise a wild squeal about the disproportionate use of force, the urgent need for a 30-day truce and new sanctions against Russia. The answer is simple: first, destroy the vile blood-sucking parasites on your dirty body. And remember: in extreme cases, orderlies destroy the bred lice with fire, burning all sources of old pediculosis!

Password: “good-naturedness.” «беззлобие»
Answer: “grunt.” «хрюкостяг»

https://t.me/medvedev_telegram/585

Very odd, and read by 1.8 million!

25MAY2025
Кремлевская табакерка

It turned out that the Doomsday radio station transmits messages from Medvedev. The politician's entourage explained what “good-naturedness” and “grunt” are. Assumptions and guesses that it is Dmitry Medvedev who comes up with the messages for the radio station were confirmed to us by sources in his entourage and in the government.

“It was not for nothing that Dmitry Anatolyevich recalled “Buzzer” in his recent post . He personally came up with the messages about “good-naturedness” and “grunt”. And he specifically explained the meaning of these messages – both to Russia and to the Kiev regime with the West. Watch for new messages, they will be important!” – a source close to the deputy chairman of the Security Council told us. Another source hinted that the post was not only about the SVO and the confrontation with the West, but also about Medvedev’s plans to replace Mikhail Mishustin as head of government ( we wrote about them ).

“Pay attention to the deep meaning of the messages. Good-naturedness is the designation of Mishustin, who wants the SVO to end as soon as possible, without our Victory, if only in the near future. And it is absolutely not suitable for the current time. And what is a grunt and why all enemies should be afraid of it, Dmitry Anatolyevich explained in his post. Everything is already serious, but it will be even more serious when Medvedev takes the post of prime minister,” the channel's interlocutor noted.

https://t.me/kremlin_secrets/5710

They are talking about https://en.wikipedia.org/wiki/UVB-76

but just the ordinary signals https://www.youtube.com/watch?v=OQuwWijc-30

16,173 posted on 05/25/2025 10:31:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16169 | View Replies]

To: BeauBo

“Cotton” railway - GUR soldiers crushed the occupiers’ military train

https://www.facebook.com/DefenceIntelligenceofUkraine/videos/659778136886144

No fuel today...


16,174 posted on 05/25/2025 10:56:59 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16169 | View Replies]

To: PIF
Re Medvedev:

8MAR2024 Medvedev’s scandalous posts coincide with wine deliveries from Italy

Former Russian President Dmitry Medvedev’s public appearances and social media posts have sunk to a new low of indecency, sparking numerous conspiracy theories. Some speculate that his public humiliations are retribution from the Kremlin for his past attempts at instituting liberal reforms. However, The Insider uncovered a more mundane explanation for the odd behavior of the deputy head of the Security Council. Despite sanctions, wine from Medvedev’s Italian vineyards continues to flow into Russia, with delivery dates conveniently preceding his scandalous publications.

This past week, Medvedev once again courted public attention with remarks that evoked a profound sense of shame and awkwardness. Clad in a blue Mao-style jacket reminiscent of Angela Merkel’s aesthetic, he addressed participants at the World Festival of Youth. Among other things, Medvedev labeled Europeans as slaves and animals, illustrating his point with distorted photo collages of European leaders from his Telegram channel.

< snip >

The pattern repeated itself in January 2023, when “samples” of wine from Medvedev’s Tuscan winery were brought into Russia by MB Group Impex, and again in July 2023, when Rue de Vin imported samples produced by Vinicola Mediterranea on the eve of a post about how “Nuclear Apocalypse is not only possible but also quite likely.” Perhaps if Medvedev’s vineyards were included in the sanctions list, it could reduce the level of toxicity on social media. However, the company Skalistyi Bereg (and thus Medvedev himself) owns its own winery in the Krasnodar region, producing 150,000 bottles per year. In this case, “import substitution” would likely prove a sufficient source of inspiration for the former president's social media habits.

https://theins.ru/en/politics/269816

What to say, maybe https://www.youtube.com/shorts/bieev679AHk

16,175 posted on 05/25/2025 11:44:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16173 | View Replies]

To: AdmSmith

16,176 posted on 05/25/2025 12:10:01 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16173 | View Replies]

To: AdmSmith
Today [ May 25 ], there are a lot of interesting updates from the Pokrovsk direction. Here, the southern fields of Pokrovsk have become the stage for one of the most critical battles in the region, now defended by Ukraine’s elite SKALA battalion.

As Russian forces attempt to break out of the fields, they are met by Ukraine’s layered defenses, where veteran drone brigades coordinate with artillery to repel the assaults with precision.

The goal of the Russian forces in this area is to reach the border of the Dnipro region. This would serve as an information victory, compensating for a lack of progress. Militarily, this would allow Russians to stabilize their western pincer and stretch Ukrainian lines further, securing their logistics network in the process.

The main Russian advantage in this area is Ukraine’s manpower shortage. This limits Ukraine’s ability to fully contest the settlements and tree lines, where Russians can press their numerical superiority. However, once Russian troops leave these covered areas and attempt to push into the open fields, their advances falter under intense Ukrainian artillery and drone fire.

The Russian attacks are further compromised by a lack of trench networks in the open fields, as the Ukrainians did not build a lot of them in the first place.

With Ukrainians not planning to hold every tree line due to their manpower shortage, Russian assault groups trying to gain ground are struggling to find large Ukrainian trenches and dugouts to shelter in. This keeps Russian soldiers out of cover for extended periods of time, making any attack a risky endeavor.

Despite a lack of sufficient manpower to cover every tree line, the Ukrainians have an abundance of drones to detect the Russian assault groups. The Czech artillery initiative provides Ukrainians with millions of artillery shells, which allow them to conduct large artillery barrages on detected Russian positions and movements.

On top of that, the Ukrainian anti-tank ditches and razor wire fortifications have created chokepoints that are easy to monitor for movement of Russian soldiers.

The recent redeployment of the elite Skala Assault Regiment reinforces Ukrainian defenses in the area. While Skala’s assault battalions are being rotated out to rest and recuperate after intense combat in the Pokrovsk sector, their experienced drone and artillery detachments remain active.

These units remain active, detecting, disrupting, and decimating Russian assaults, allowing Ukraine to hold ground with fewer troops, while preserving its main assault forces and wreaking havoc on Russian forces.

Geolocated combat footage from the area reveals a pair of Russian soldiers trying to cover themselves in a sparse tree line and play dead, to avoid being struck by the Ukrainian drones. However, the Ukrainians detected everything that moved, and as a result, both Russian soldiers were eliminated.

The Ukrainians are therefore forcing every surviving Russian soldier to be on a constant run in hopes of finding a trench or dugout to save their lives, as stopping would lead to their immediate elimination. To avoid being struck, Russian soldiers are using motorcycles to reach the Ukrainian positions, since they are more difficult for drones to track and strike. However, the Russian motorcycle assault units had their way blocked by anti-tank ditches prepared by the Ukrainians.

This gives ample time for the Ukrainian drone operators to carefully target and eliminate the Russian forces that are being funneled into a kill-zone. Notably, one Russian motorcyclist attempted to jump over an anti-tank ditch with his motorbike, however, he misjudged the width of the ditch, and fell short, immediately being hit by a drone-dropped grenade. This careful utilization of open terrain, observation of predictable attack routes, and field fortifications allows the Ukrainians to compensate for their manpower shortage.

Overall, the Ukrainians maintain an effective defense to the south of Pokrovsk, fending off against numerically superior Russian units and forcing them into brutal grinding assaults, with no cover to shield them. With the SKALA regiment’s veteran drone and artillery units reinforcing the defense, Russian soldiers seem to stand no chance at all.

The intensification of Russian attacks across the whole of the Pokrovsk direction is most prominent here, as they desperately need to widen their western pincer to continue their effort to take Pokrovsk into a pocket, as they seek to avoid a repeat of the grueling and costly urban battle raging in Toretsk.

https://www.youtube.com/watch?v=f-x7iNJ6T7Q

16,177 posted on 05/25/2025 12:12:42 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16175 | View Replies]

To: AdmSmith
No fuel today?

Meeting on preparations for upcoming talks with Ukraine

This conversation has effectively taken place and lasted more than two hours. I would like to emphasise that it was both substantive and quite candid. Overall, I believe it was a very productive exchange.

First and foremost, I expressed my gratitude to the President of the United States for the support provided by the United States in facilitating the resumption of direct talks between Russia and Ukraine aimed at potentially reaching a peace agreement and resuming the talks which, as we know, were thwarted by the Ukrainian side in 2022.

The President of the United States shared his position on the cessation of hostilities and the prospects for a ceasefire. For my part, I noted that Russia also supports a peaceful settlement of the Ukraine crisis as well. What we need now is to identify the most effective ways towards achieving peace.

We agreed with the President of the United States that Russia would propose and is ready to engage with the Ukrainian side on drafting a memorandum regarding a potential future peace agreement. This would include outlining a range of provisions, such as the principles for settlement, the timeframe for a possible peace deal, and other matters, including a potential temporary ceasefire, should the necessary agreements be reached.

Contacts among participants of the Istanbul meeting and talks have resumed, which gives reason to believe that we are on the right track overall.

I would like to reiterate that the conversation was highly constructive, and I assess it positively. The key issue, of course, is now for the Russian side and the Ukrainian side to show their firm commitment to peace and to forge a compromise that would be acceptable to all parties.

Notably, Russia’s position is clear. Eliminating the root causes of this crisis is what matters most to us.

Should any clarifications be necessary,

16,178 posted on 05/25/2025 12:14:18 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16174 | View Replies]

Round 3

⚡ – 60 Russian Drones Enter Ukrainian Airspace

A swarm of 60 Russian drones has reportedly entered Ukrainian airspace.

pic.twitter.com/zpDpNnUskI— Zlatti71 (@Zlatti_71) May 25, 2025


16,179 posted on 05/25/2025 12:46:12 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16178 | View Replies]

To: admin; Sidebar Moderator; JR; JonPreston

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
https://freerepublic.com/focus/f-bloggers/4219673/posts?q=1&;page=16001

Once again JonPreston is reposting without a source, material I posted previously

This time he changed the article date from May 20 to May 25.

Original date:
Today [ May 20 ], there are a lot of interesting updates from the Pokrovsk direction.
16,018 posted on 5/21/2025, 6:32:48 AM by PIF

Forgery by Preston
Today [ May 25 ], there are a lot of interesting updates from the Pokrovsk direction.
16,177 posted on 5/25/2025, 2:12:42 PM by JonPreston ( ✌ ☮️ )

This has to stop. Preston is deliberately trying to destroy this thread, a goal he has previously announced. Why is this egregious behavior allowed to continue without any apparent reprimand.


16,180 posted on 05/25/2025 1:08:18 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16177 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,141-16,16016,161-16,18016,181-16,200 ... 21,461-21,462 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson