Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,081-16,10016,101-16,12016,121-16,140 ... 19,381-19,383 next last
To: JonPreston
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌

16,101 posted on 05/23/2025 1:13:14 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16100 | View Replies]

To: FtrPilot

16,102 posted on 05/23/2025 1:14:08 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16052 | View Replies]

To: FtrPilot

“pays for the damage it has caused to Ukraine”

That is more than $300 billion.

Maybe they can work out terms, where Russia gets some money back up front, for agreeing to supply steady pipelines full of oil and natural gas, for the next 20-50 years.


16,103 posted on 05/23/2025 3:21:00 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16083 | View Replies]

To: scan_complete
Kiev is on fire thanks to Zelensky


16,104 posted on 05/23/2025 5:24:25 PM PDT by scan_complete
[ Post Reply | Private Reply | To 15613 | View Replies]

To: BeauBo

Kyiv Independent:

“Ukraine and the United States have officially launched a joint Reconstruction Investment Fund as part of their minerals agreement, Economy Minister Yuliia Svyrydenko announced on May 23.

“The last step was a diplomatic note from the United States, which I personally received this morning from Julie S. Davis, the U.S. Chargé d’Affaires. The Fund is officially launched,” Svyrydenko wrote in a Facebook post.

The fund is a core component of the broader U.S.-Ukraine minerals agreement, signed on April 30.”


16,105 posted on 05/23/2025 6:17:06 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16103 | View Replies]

To: BeauBo; FtrPilot
Here is what Stalin demanded from Finland after the war:

Finland paid a heavy price for their alliance with Germany in World War II. Though it was the Soviets who initiated the conflict in 1939, they insisted Finland pay reparations as terms of the Moscow Armistice and maintaining independence. After significant debate, the total of reparations amounted to $300 million US (more than $6 billion today), and were mostly non-monetary in nature.

The weight of these payments was hugely significant. In the first five years following the war the payments represented between 5 and 6 percent of the gross national product (GNP).

https://scancan.net/index.php/scancan/article/download/255/516

Of course Russia has to pay reparations to Ukraine after the war. In addition to the $300 billion, it will be part of the revenues from oil and gas as you wrote.

16,106 posted on 05/24/2025 12:25:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16103 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, May 23, 2025

Russian Foreign Minister Sergei Lavrov demanded that any future peace agreement in Ukraine include conditions to prevent the election and establishment of future pro-Western governments in Ukraine. Lavrov insisted on May 23 that any peace agreement must include conditions preventing the “repetition of what brought putschists to power through a bloody revolution,” referring to Ukraine's 2014 Euromaidan protests and the Revolution of Dignity, which drove out Ukraine's former pro-Russian president Viktor Yanukovych.[1] Lavrov also reiterated Russian President Vladimir Putin's repeated claim that Ukrainian President Volodymyr Zelensky is not the legitimate leader of Ukraine and claimed that Russia could negotiate with the leadership of Ukraine's Verkhovna Rada (parliament) instead of Zelensky.

Russian officials often deliberately misread the Ukrainian Constitution to claim that Zelensky’s government is illegitimate since Ukraine did not hold presidential elections in 2024, although the Ukrainian Constitution and law prohibit the government from holding elections during times of martial law and external aggression.[2] Russian officials have repeatedly characterized Ukraine's Euromaidan protests and Revolution of Dignity as a “coup,” and leverage this narrative to reinforce Russia's claims that the current Ukrainian government is not legitimate and thus cannot negotiate with Russia.[3] Lavrov’s statement is also an explicit demand for regime change in Ukraine as a condition of any future peace agreement – a demand that Russian officials routinely make under the guise of demands for “denazification” in Ukraine.[4] Russian officials will likely falsely frame any future pro-Western government in Ukraine as inheriting the illegitimacy of all Ukrainian governments since 2014 and set conditions to claim that any agreement that Russia concludes with Ukraine is non-binding.

Lavrov also rejected US President Donald Trump's recent suggestion that the Vatican could host negotiations on Russia's war against Ukraine.[5] Lavrov claimed that negotiations in the Vatican would be “unrealistic” and that it would be “uncomfortable” for the representatives of “two Orthodox countries” to meet in the Vatican.[6]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-23-2025

16,107 posted on 05/24/2025 12:55:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16086 | View Replies]

Day 1,184 of the Muscovian invasion. 1,050 [average is 826/day], i.e. more than 43 Russians and Norks/h. Vehicles and fuel tanks more than 230% and artillery more than 80% above average. Motorcycles are not counted yet.


16,108 posted on 05/24/2025 1:02:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16033 | View Replies]

A Syrian armed group claimed a May 20 attack on Russian forces at Hmeimim air base and gave the Russians one month to leave Syria before it attacks again.[37] A group of fighters attacked Russian forces stationed at Hmeimim air base, Latakia Province, on May 20, and killed two Russian soldiers.[38] A group known as “Burkan al Furat” claimed the attack on May 21 and acknowledged that two of its fighters were killed, including ex-Hayat Tahrir al Sham (HTS) military trainer Abu Jihad Masri.[39] Burkan al Furat commander Mohammad al Shami warned in a separate statement that the group will attack Russian forces again if they do not withdraw from Syrian territory within one month.[40] Burkan al Furat appears to be comprised of former FSA and Syrian National Army (SNA) fighters from northeastern Syria, according to Syrian and Lebanese media.[41] The group reportedly participated in the HTS-led offensive that toppled the regime.[42] Shami identified his fighters as former “HTS brothers“ and referred to Burkan al Furat as part of the Free Syrian Army (FSA).[43] This characterization indicates that the group did not act under Damascus's orders when it attacked Hmeimim, despite some of its fighters’ former associations with HTS.

Burkan al Furat’s threat to attack Russian forces if they do not withdraw from Syrian territory within one month is unlikely to compel the Russians to withdraw. Damascus has allowed limited Russian forces to remain at Hmeimim after the majority of Russian forces withdrew from Syrian territory in December 2024.[44] Russia has sought to maintain bases that it previously held before the fall of the regime, including the port of Tartous, and is therefore unlikely to withdraw, barring direct orders from Damascus.[45] Syrian President Ahmed al Shara does not appear to have decided on the future of Russian influence in Syria. Recent and newfound high-level engagement with the United States may influence Shara’s calculations.

https://www.understandingwar.org/backgrounder/iran-update-may-23-2025

16,109 posted on 05/24/2025 1:08:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16108 | View Replies]

To: PIF; gleeaikin
14MAY 2025 Кремлевская табакерка
They want to ban wives of active participants and veterans of the SVO from divorcing them for at least 4 years

https://t.me/kremlin_secrets/5667

24MAY2025 Кремлевская табакерка

Are “Black Widows” Being Killed in Russia? Military Says Crazy Version

At least three women who recently officially married military personnel have died in the past month. Two cases were recorded in Krasnodar Krai and one in Kursk Oblast. There are rumors among military personnel and their wives that someone has started killing so-called “black widows.” This is the name given to women who marry or start relationships with SVO members, receiving significant sums of money from them and (after the marriage is formalized) claiming payments in the event of their death. The phenomenon has become quite widespread in recent years.

“We would not rush to connect all three cases, but yes, we are talking about three murders. Two women were found dead as a result of attacks, and another was poisoned,” said a source in the Investigative Committee of the Russian Federation.

It is worth noting that the personal lives of SVO members are increasingly becoming a subject of discussion in the media. Frequent infidelities of SVO members are no secret. Many military personnel do not hide the fact that they lead a double life, and single men are happy that there are women who are ready to share their difficult life path. Even if it is for money. But there are some moralists in society who advocate strict restrictions in terms of “funeral” payments and even tightening control over all military personnel's funds. They are also already publicly talking about bans on divorce for participants in the SVO .

On the other hand, after the death of military personnel, relatives are forced to conflict with a new wife, who often appears quite unexpectedly. “Black widows” are specifically looking for stormtroopers, men of dangerous professions, who are more likely to die at the front,” a source in the Ministry of Defense shares an insider story. Against this background, in closed chats, contacts of people who “can solve any problem” are handed over from hand to hand. “You can check your wife for infidelity. You can do something more serious,” a source familiar with the situation explained to us. We will continue to monitor this situation.

https://t.me/kremlin_secrets/5706

16,110 posted on 05/24/2025 2:21:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16109 | View Replies]

Day 1,185 of the Muscovian invasion. 1,130 [average is 826/day], i.e. more than 47 Russians and Norks/h. AFV more than 145%, vehicles and fuel tanks more than 450%, tanks more than 20%, and artillery more than 50% above average. Motorcycles are not counted yet.


16,111 posted on 05/24/2025 2:28:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16108 | View Replies]

Russians warned of frequent network shutdowns due to drone attacks.

The information about this was reported by the Telegram channel Baza, citing its sources. The decision was made due to the effectiveness of such a fight against attacks by unmanned aerial vehicles (UAVs). The method was first used on May 6. Then it was discovered that UAVs began to be controlled using installed cellular modules.

At the same time, the technology of disconnecting the mobile network is quite simple to use. The operator can quickly disconnect communication at several base stations at the direction of the special services.

On May 21, 2025, a large-scale shutdown of mobile Internet occurred in a number of Russian regions, including Moscow, Tula, Lipetsk, and Voronezh. According to official sources, the restrictions were introduced due to the risk of an attack by unmanned aerial vehicles (UAVs).

https://cybersport.metaratings.ru/news/rossiyan-predupredili-o-chastykh-otklyucheniyakh-seti-iz-za-atak-bpla-483669/

16,112 posted on 05/24/2025 3:11:11 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16111 | View Replies]

To: AdmSmith; All
🍈

The price of a borscht set in Russia has increased by 57-87% over the year, with official inflation at 10%. On average, citizens spent 34.6% of their expenses on food, compared to 33% at the beginning of the year and 28.6% in April 2024. According to Romir, this is a record for 5 years

https://bsky.app/profile/evgen-istrebin.bsky.social/post/3lprf4r5erk2a

At least 6000 Russian officers have been eliminated in the Russian invasion of Ukraine since 24 February 2022. Milestone update: +31 newly registered. Sources: public Russian obituaries and graves.

https://x.com/KilledInUkraine/status/1922752446335488341

Officers in a Russian rifle regiment are said to be labelling men as deserters to avoid paying them, beating them, denying medical care, forcing female medics into sex, and sending men into assaults without equipment while telling them to scavenge it on the battlefield. ⬇️

2/ The wives, mothers and sisters of men serving with the Russian 54th Motorised Rifle Regiment have published an ‘appeal to the Tsar’ complaining that their “husbands, sons and fathers are subjected to illegal actions by inhuman beings endowed with power,” i.e. army commanders.
3/ One of the mothers says that in the unit, soldiers are illegally labelled as deserters – even when they are still serving – to deprive them and their families of wages and compensation. They are also denied treatment when they are wounded.
4/ “The fighters are not given medical care, but are handcuffed and beaten. When they leave for a combat mission, the fighters are robbed of their phones, maps, personal belongings, and then all of this is simply lost and disappears.”

5/ “The guys are practically not evacuated. If the guys are wounded, they crawl to the designated place, bleeding. Dead soldiers are not evacuated.
6/ “If the guys are wounded, they end up in the hospital with shrapnel, with serious wounds, they are not sent home for rehabilitation, they are sent back into battle. The guys never return from there.”
7/ They also say that supplies of ‘humanitarian aid’ sent to the soldiers by relatives and volunteers never arrives, but is simply sold (likely by officers or corrupt logistics personnel; this is a common occurrence).
8/ The relatives say that “commanders are asking for money so that servicemen do not go on combat missions.” If soldiers are seen as ‘undesirable’ or insubordinate they are “zeroed out”, or killed.
9/ According to the relatives, men are sent into assaults with little equipment and are told to scavenge what they need on the battlefield, presumably from the corpses of those who were sent before them.
10/ The relatives ask: “They are sending them to a place from which it is practically impossible to return. They are sending people who are not properly trained or prepared. The question is simple: why is all this being done?”

more text: https://threadreaderapp.com/thread/1923436271117984070.html

16,113 posted on 05/24/2025 3:46:40 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16112 | View Replies]

To: BeauBo
JD Vance Issues New Warning: ‘Era of Uncontested US Dominance Is Over’

He said that the U.S. was a “superpower without any peer” for a brief time following the collapse of the Soviet Union, but the global stage has since changed. “The era of uncontested U.S. dominance is over. Today we face serious threats in China, Russia and other nations determined to beat us in every single domain—from spectrum to low earth orbit to supply chains to even our communication infrastructure,” Vance said.

https://www.newsweek.com/jd-vance-warns-era-uncontested-us-dominance-over-2076628

16,114 posted on 05/24/2025 3:55:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16105 | View Replies]

Update from Kupiansk region (various internet sources)

Intense clashes suddenly broke out. Russian forces finished regrouping and decided to initiate a renewed wave of attacks on Synkivka.

The village of Synkivka is the key to unlocking the operational space and allowing for the Russian advancement north of Kupiansk, so the precipitation of the pace of the offensive operation here is not surprising.

What is surprising is that Russians launched this wave of attacks without adequately setting the stage for a successful campaign.

As you remember, Russian forces have already tried to take Synkivka through straightforward frontal assaults.

Even though they did enjoy some levels of success at the beginning of the undertaking, Ukrainian counterattacks not only reclaimed any lost footing in the village, but also drove Russian forces back into the cover of the forest.

That was the main reason why Russians tried to rethink their approach, which even seemed to result in significant tactical adjustments.

As noted by many military analysts, these adjustments happened in the forest. Russians tried to expand their control over at least a portion of the forest in front of the settlement in order to eliminate the possibility of Ukrainian flank maneuvers and broaden the range of assault angles that they could create.

That is why, up until now, intense clashes have taken place in the forest. Despite some Russian claims of incremental gains within the forest, these were not broadly corroborated. Logically, if Russians indeed advanced deeper into the forest, then they would open new vectors of attack.

However, evidence from geolocated footage indicated that recent Russian offensives targeted the same areas as before.

This serves as a direct confirmation of the fact that Ukrainians in the forest managed to withstand Russian assaults by utilizing the forest’s natural barriers against mechanized assaults and traps and mines against infantry assaults.

The successful Ukrainian defensive operation in the forest left Russians with no choice but to resort to costly assaults across mine-laden territories toward Ukrainian defensive positions.

According to Kharkiv Military Administration Head Oleh Synehubov, Russian forces conducted a series of mechanized advances using MT-LB armored fighting vehicles instead of tanks.

Some Russian sources reported that after two days of non-stop fighting, Russian forces managed to establish control over several Ukrainian trenches in front of the village. Geolocated images show several assaults that confirm these marginal advances in the northeastern part of the stronghold.

Moreover, recent reports from Russian outlets suggest a surge in partisan activities aimed at disrupting Ukrainian logistics through sabotage in at least five villages northwest and southwest of Kupiansk.

These actions seem to be an attempt to amplify the effects of the fresh military assaults and to derange the Ukrainian logistics.

As a result of all these recent Russian efforts, different sources from both sides finally confirmed that Russian forces regained control of a trench area between Synkivka and the forest.

Geolocated night vision images released by the Ukrainian 30th Mechanized Brigade show artillery targeting these newly secured Russian positions. These trench positions appear to be in a small isolated tree grove northwest of Synkivka, about 600 meters from the edge of the forest.

Another striking video shows how incredibly close the Russian and Ukrainian positions are. The footage shows the shocking moment when two Russian soldiers leave their positions in a suicidal attempt to storm the Ukrainian positions located just meters away.

Unfortunately for the Russians, a Ukrainian reconnaissance drone just happens to be recording the attempt. The drone operator tracks the Russian soldiers in their race and has time to warn the Ukrainian side, which manages to finish off the attackers in their approach.

The images prove the utmost importance of being alert at all times, particularly with such close enemy positions, and the vital importance of drones in this war, not only in offensive actions, but also in defensive roles.

Additional footage shows Ukrainian counterbattery fire in action. Russian forces initiate artillery preparation prior to the assaults, revealing their position. Moments later, the video shows an MSTA-C howitzer being hit by Ukrainian counterbattery fire.

The latest footage indicates Ukrainian FPV drone operators’ efforts to hit as far as Lyman Pershyi, the most significant Russian base in the area. The images show an attack on a Russian drone operator’s base in the settlement.

Overall, Russian forces showed no significant improvements as a result of their adjustment efforts in the woods. Due to the fact that they failed to broaden the range of assault angles, Russian forces resorted to highly attritional tactics by building up forces along the contact line and then using them to achieve marginal advances.

Ukrainian forces remain vigilant and commit many drone and artillery resources to wipe out these Russian accumulations and undermine the Russian offensive efforts.

By the way, one of the reasons why the Russian offensives in the Kupiansk direction became less successful is that Ukrainians forced Russians to relocate some troops to save other fronts.

https://t.me/s/kremlin_secrets

The Czech Republic bought 800,000 shells for Ukraine. Including Russia’s allies. Why is this a dangerous precedent?

The Ukrainian Armed Forces will soon receive 500,000 artillery shells of 155 mm caliber and 300,000 shells of 122 mm caliber. The Czech Republic agreed on the supply of such quantities of ammunition to Ukraine, using money from Kyiv’s allies and its connections.

The shells were purchased from 3rd countries, which, according to our intelligence, include some of our allies.

The information itself about the supply of 800,000 shells is no longer a secret. It was previously announced by Czech President Petr Pavel. The fact is that the Armed Forces of Ukraine are experiencing a serious shortage of shells and the military industry of the West, apparently, cannot cope with the required volumes of supplies. Our side uses several times more shells, but here North Korea came to the rescue.

According to our sources, the number of countries that sold shells to the Czech Republic for the Armed Forces of Ukraine included a number of states in the Global South and several African countries. Negotiations on supplies lasted several years.

16,115 posted on 05/24/2025 4:10:57 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16113 | View Replies]

To: BroJoeK
following the collapse of the Soviet Union

Thank you for referencing the collapse of the Soviet Union. I've been saying this for years despite resistance from the small cadre of Bitter Clingers who post here.

16,116 posted on 05/24/2025 4:42:36 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16114 | View Replies]

To: AdmSmith

lol collapse, ask pitin and his ilk, the Soviet Union was never actually dissolved, that’s the new talking point


16,117 posted on 05/24/2025 6:09:34 AM PDT by blitz128
[ Post Reply | Private Reply | To 16114 | View Replies]

To: AdmSmith

What do you think, June 11th or 12th, for Putin to rack up a million Russian casualties?

He will have earned a special place in Hell.


16,118 posted on 05/24/2025 6:17:16 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16111 | View Replies]

To: BeauBo

And those are just the ones that could be counted, omitting those that were left to rot down to bones & those that are just pieces and parts, scattered who knows where. And, of course, omitting al the LNR/DNR meat wave troops that were never counted.


16,119 posted on 05/24/2025 6:28:11 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16118 | View Replies]

To: BeauBo

Maybe sooner ...


Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Hundreds of Russians Blown Apart in Bahatyr Massacre! ]

Today [ May 22 ], there is interesting news from the Kurakhove direction. Here, the Russians attempted to disrupt the rear of the Ukrainian defense line by conducting a rapid uppercut attack. As it turned out, the Ukrainians were already expecting it, annihilating the Russian vanguard, and leaving hundreds of dead Russians in the fields.

In their continued push through the southwestern sector of Donetsk Oblast, Russian forces launched yet another costly and futile operation, this time aimed at capturing the village of Bahatyr. The strategic ambition behind the offensive is clear, as the Russian command wants to press along the Zaporizhia-Kostiantynivka highway, potentially advancing toward the regional border between Dnipro and Donetsk.

This objective offers no real operational or strategic value but is driven by symbolic value and territorial optics, seizing more land to claim informational victories and extending the buffer zone around Donetsk city.

To achieve this, Russia has pursued a series of tactical maneuvers designed to cut off Ukrainian positions along the highway. These so-called uppercut movements seek to rupture Ukrainian lines from the south, bypassing major defenses to isolate positions further west. The pattern has already emerged: first Dachne, then Ulaky, then an attempted advance toward Kostiantynopil, each involving flanking efforts aimed at squeezing Ukrainian logistics and forcing staggered withdrawals. Bahatyr became the latest focal point in this creeping assault.

Operationally, Russia tries to storm Bahatyr with a combination of motorcycle and quad-bike rush tactics. These rapid assaults target the village’s flanks and field roads, with the intent to infiltrate residential areas, occupy basements, and build up numbers to contest control. Tactically, this kind of assault depends on speed and shock, catching defenders off balance, before reinforcements can respond.

But Ukrainian forces were ready, and the result was a disaster for Russia. In what can only be described as a massacre, dozens of Russian troops were killed in open terrain as they attempted to cross mined fields and exposed roads. Ukrainian kamikaze drones struck with devastating precision, obliterating motorcycle teams mid-advance.

Minefields tore through columns of bikes and quads. Grenades dropped by drones finished what remained. Russian corpses and wreckage littered the approaches to the village, turning the attempted assault into a bloodbath. The attack failed to even reach its staging objectives, and most of the force was annihilated before reaching shelter.

Some Russian soldiers did manage to infiltrate parts of Bahatyr, during night movements or under the cover of fire. When this happened, Ukrainian special forces launched immediate clearing operations. These are not random responses, but pre-coordinated sweeps designed to prevent Russian troops from consolidating within the village.

Ukrainian tactics here focus on denying the enemy the time or space to build up critical mass inside the settlement. If left unchecked, even small Russian infiltration units could become a foothold, capable of drawing more forces and exerting rear pressure on Ukrainian lines to the north.

The counterattacks proved successful, and by the end, Ukrainians had ensured the village was 95% free of enemy presence, securing its functionality as a defensive position, as holding Bahatyr is vital. By nullifying all Russian gains, and making the Russians lose hundreds of soldiers for nothing, the Ukrainians underscored the futility of the Russian attacks and the general Russian approach to the war, where thousands are thrown each day into the meat grinder with more political than military logic, and yet the results are missing.

Overall, Russia’s reckless assault on Bahatyr achieved nothing but losses. If they have managed to establish control there, the Russians would have had a launchpad to undermine the defense of Kostiantynopil and force Ukrainian units to retreat, not because of direct defeat, but due to severed supply lines and the looming threat of encirclement. For Ukraine, however, the successful defense and counteraction show how discipline, coordination, and clever usage of weapons like drones and mines can turn even a vulnerable frontline village into a fortress and a graveyard for the invaders.

https://www.youtube.com/watch?v=MoKYF_YYAuQ


16,120 posted on 05/24/2025 6:37:05 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16118 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,081-16,10016,101-16,12016,121-16,140 ... 19,381-19,383 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson