Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,581-15,60015,601-15,62015,621-15,640 ... 19,421-19,424 next last
To: blitz128
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )

15,601 posted on 05/09/2025 2:42:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15600 | View Replies]

To: BeauBo

Yes, but pitin can still put on a nice parade. Looks like about a month worth of losses worth of men and equipment


15,602 posted on 05/09/2025 3:33:01 AM PDT by blitz128
[ Post Reply | Private Reply | To 15593 | View Replies]

To: AdmSmith

I am surprised that Ukraine did not target the Military sites that had their Air Defense pulled for the parade.


15,603 posted on 05/09/2025 4:38:11 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15594 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Ukrainians Take Crimea By Storm! ]

Today [ May 7, 8 pm ], there is important news from Crimea. Here, the Ukrainians conducted a massive, combined air and sea drone strike against the Crimean Peninsula with devastating results. With Ukrainians threatening this would be just the beginning, panic spread throughout the Russian government that the most important event in their calendar is under immense threat.

Firstly, Ukrainians launched a massive drone strike targeting Russian military assets across Crimea and the Black Sea. Utilizing a combination of aerial and naval drones, Ukrainian forces launched a highly coordinated assault, systematically dismantling layered Russian defenses. The operation began with precision strikes on key air defense and electronic warfare systems, neutralizing Russia’s ability to detect and intercept incoming threats.

Once these systems were degraded, Ukrainian drones targeted patrol boats and airfields, paving the way for deeper strikes, and exposing vulnerabilities in Russia’s coastal and aerial security. Notably, Ukraine’s military intelligence agency deployed Magura V5 and V7 naval drones equipped with R-73 infrared air-to-air missiles. Recently released footage shows how Ukrainians used them to target one Russian Su-30 fighter jet and successfully downed the aircraft, a historic first in naval drone warfare.

The strikes were widespread, with Ukrainian drones reported over areas including Zhuravlivka near Simferopol, Orlovka, Tarkhankut, and Yevpatoria, destroying numerous targets like an air defense system S-300, an Obzor-3, Kasta-2E2, ST-68, and Imbir radars.

The Belbek, Hvardiiske, Saky, and Kacha airfields, and the Kirovske military air base were also targeted, as they are used by Russia to control airspace over the Black Sea and launch strikes on Ukrainian territory.

The important Russian radio-technical intel complex Zvezda near Stavropol was hit again, critical for Russian satellite communication. The Russian Ministry of Defense claimed to have intercepted 112 drones in total, yet the scale and precision of the attacks indicate a significant breach in Russian defenses.

Numerous reports from eyewitnesses from the peninsula confirm that, despite Russian claims, there were a substantial number of explosions to be heard and seen, a clear indication that not all drones were intercepted.

As fires still raged, Ukrainian President Volodymyr Zelenskyy issued a threatening statement that Ukraine could not guarantee the safety of world leaders attending Russia’s upcoming Victory Day Parade on the 9th of May.

Ukrainian military intelligence chief Kyrylo Budanov suggested that visitors to Moscow might need earplugs, further hinting at potential disruptions. Notably, while the parade itself will unlikely be a direct target due to the high risk of civilian casualties, the military equipment and personnel assembled in grouped-together locations, before and after, the event present legitimate military targets.

In response to the heightened threat, Russia has reportedly already redeployed over 280 air defense systems, including S-400, Tor, and Buk air defense systems, as well as radars and electronic warfare equipment to Moscow to bolster security for the Victory Day Parade.

Zelensky’s warning has also contributed to several foreign leaders cancelling their attendance. Serbian President Aleksandar Vučić and Indian Prime Minister Narendra Modi have cited health reasons for their absence, while Russia’s closest ally, Belarusian President Alexander Lukashenko, announced he might be late. Slovak Prime Minister Robert Fico expressed concerns over Zelenskyy’s warnings, but still plans to attend; however, his flight plans over European airspace are reportedly being denied instead.

Unfortunately for the Russians, the redeployment of at least 280 highly effective air defense assets to Moscow has left other regions vulnerable, without the necessary protection. Ukraine has previously demonstrated its capability to strike high-value targets as far as 1,800 kilometers from the front line, including Russian naval vessels, critical infrastructure such as oil refineries, strategic airfields, and huge Russian artillery arsenals.

With Russian air defenses stretched even thinner, already depreciated by Ukrainians increasingly targeting and destroying these assets in the past, massive gaps are appearing in Russia’s air defense network, with the recent strikes in Crimea appearing to be just the beginning of something much bigger.

Overall, after the devastating strike on Crimea, President Zelenskyy’s remarks have unsettled the Russian government, prompting a reactive and resource-intensive shift of air defense assets. By forcing Russia to concentrate huge amounts of air defenses around Moscow, Ukraine has created opportunities to strike elsewhere, potentially leading to significant losses for Russia in the coming days. This not only threatens Russia’s military assets but also challenges the internally perceived invulnerability of the Russian state

https://www.youtube.com/watch?v=hp5-YuB9qt8


15,604 posted on 05/09/2025 5:57:00 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15603 | View Replies]

To: BeauBo
I am surprised that Ukraine did not target the Military sites that had their Air Defense pulled for the parade.

You didn't actually want the parade targeted, did you?

Victory Day

Victory day:

Victory Day is a holiday that commemorates the victory of the Soviet Union over Nazi Germany in 1945. It was first inaugurated in the 15 republics of the Soviet Union following the signing of the German Instrument of Surrender late in the evening on 8 May 1945 (9 May Moscow Time). The Soviet government announced the victory early on 9 May after the signing ceremony in Berlin.

bigger

A live feed of the Victory Day parade 2025 in Moscow can be watched here.

Posted by b at 7:51 UTC | Comments (11)

15,605 posted on 05/09/2025 6:02:32 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15603 | View Replies]

To: JonPreston

You are the one who advocated for bombing the parade (post 15,564).

Not only that it should be bombed, but that we must bomb it.

Fundamentally, and deeply dishonest of you.

Again.


15,606 posted on 05/09/2025 6:19:00 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15605 | View Replies]

To: blitz128

15,607 posted on 05/09/2025 6:22:12 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15602 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Kursk Offensive Continues. Dragon Teeth Breached! Bridges and Command Centers Destroyed! ]

Today [ May 8, 8 pm ], there is interesting news from the Kursk direction. Here, the Ukrainians launched another surprising incursion through the border. This is putting extra pressure on the Russian reserves and could force them into an overreaction that can lead to even more serious problems for them and result in an operational-level penetration and crisis.

Ukraine has launched a new incursion, opening a new chapter of its border raids with the clear goal to open a fresh front, stretch Russian defenses even further, and exploit vulnerabilities, especially as Russian forces remain engaged with the earlier Ukrainian operations in Belgorod and the initial Kursk assault.

The Ukrainian plan incorporates creating multiple simultaneous threats along the border, and strategically prevents the Russians from focusing on their Donbas summer campaign by baiting them into costly defensive operations in Kursk.

The incursion started with well-timed preliminary strikes, with the Ukrainian Air Force hitting a Russian drone command center near the village of Tyotkino, reportedly killing up to 20 Russian personnel, including drone operators and commanders. This attack likely crippled local Russian drone coordination, crucial for both reconnaissance and counter-strike capabilities. I

In tandem, Ukrainian forces shelled Tyotkino and engaged in a battle near the railway station, while Ukrainian aviation destroyed a bridge near the village of Zvannoe, to isolate the Russian defenders. These actions disrupted Russian mobility and communications, laying the groundwork for the main effort.

Towards Tyotkino, Ukrainians launched a sophisticated maneuver, aiming to isolate Russian forward positions, which were already vulnerable due to their exposure on 3 sides. A pontoon crossing was set up, and engineering units breached Russian fortifications successfully. This initial push appeared to be a reconnaissance-in-force, exposing Russian firing positions for targeting by Ukrainian FPV drones, which now dominate the area, attacking Russian logistics.

The Ukrainian decision to evacuate border settlements, signals plans for more intense fighting, likely involving more substantial forces, and suggests that Ukraine is preparing to hold and expand its gains in the area.

In the next step of the operation in the Novi Put direction, the local “dragon’s teeth” defenses were already compromised since September last year, so Ukrainian armored vehicles moved in after mine-clearing operations, exploiting a pre-existing gap without conducting a full-scale breaching assault. This allowed for rapid penetration and complicated the Russian tactical response.

As Russian positions in Tyotkino are essentially surrounded from the start, if the Russians stubbornly and at all costs try to hold them, and then, in the event of a loss, attempt to retake them just as stubbornly, the Russian army could suffer heavy losses. Russian analysts suggest that this may not be the Ukrainians’ main offensive, but rather a diversion aimed at drawing off Russian operational reserves and conducting their main strike in a completely different direction.

Should Ukrainian troops secure Tyotkino and establish fortified positions there, they will gain a key foothold to disrupt Russian supply lines in depth and potentially threaten the logistical heart of this part of the Kursk region. As Ukrainian forces that withdrew earlier from the first Kursk incursion were not destroyed, but are still combat-effective, they can now be reinserted into action, giving Ukraine the initiative.

This would extend even more pressure over the Russian command to throw its forces in a counterattack, which would be doomed to end in disaster with huge losses, due to the terrain and Ukrainian drone dominance.

A logical next step for Ukraine, if the current effort succeeds, would be a push toward Glushkovo. Capturing ground along the Seym River could effectively cut Russian communications to the west, isolating multiple positions and paving the way for a new broader Ukrainian presence in Kursk Oblast.

If this happens before or during Victory Day on May 9, it would not only be a military blow to Russia, but a psychological one as well, overshadowing a key symbolic date. Success in Kursk would undo Russia’s gains from March and April and serve as a morale-boosting milestone for Ukrainian forces.

Overall, the newest incursion into Kursk is not an isolated action, but a deliberate continuation of Ukraine’s border pressure campaign. Combined with the earlier Belgorod operation, it represents a clear attempt to overstretch Russian military capacity, disrupt reinforcements to Eastern Ukraine, and deny the Russian command any breathing room.

https://www.youtube.com/watch?v=gECs9NRItsY


15,608 posted on 05/09/2025 6:24:46 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15607 | View Replies]

To: BeauBo
1,300 casualties in a day, while they are supposedly observing a ceasefire.

On May 8, there were 193 recorded combat engagements on the frontline, with Ukrainian Defense Forces repelling the highest number of Russian assaults in the Pokrovsk sector.
According to Ukrinform, this was reported by the General Staff of the Armed Forces of Ukraine on Facebook, reflecting the situation as of 8:00 on Friday, May 9.

Additionally, the invaders carried out nearly 4,000 shelling attacks, including 67 from multiple rocket launch systems, and used 2,659 kamikaze drones.

Russian airstrikes targeted areas including Brusky, Boyaro-Lezhachi, Vorozhba, Yastrubyne, Bilopillia, and Nova Sloboda in Sumy region. Russian forces launched one missile strike and 18 airstrikes at Ukrainian positions and populated areas, using one missile and dropping 32 guided aerial bombs.

Video of the day

https://www.ukrinform.net/rubric-ato/3990961-war-update-71-assaults-repelled-in-pokrovsk-sector-193-engagements-along-frontline-over-past-day.html

15,609 posted on 05/09/2025 6:30:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15593 | View Replies]

To: BeauBo
You are the one who advocated for bombing the parade (post 15,564)

Dimko Zhluktenko 🇺🇦⚔️ (@dim0kq) said that in a Tweet on May 7, 2025.

I posted his link in #15564

Now, let me ask again, why on earth would you advocate for bombing the parade?

15,610 posted on 05/09/2025 6:46:04 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15606 | View Replies]

To: PIF
Кремлевская табакерка

The Kremlin believes that this is “the last Victory Day during the SVO.” And they are concerned about Putin's crosses

A high-ranking source in the Kremlin made the statement that “the next Victory Day, in 2026, the SVO will most likely no longer exist.” “Many of us are talking about this, but not very openly yet. You will see, it will be as I said,” the channel's interlocutor assured. At the same time, he did not specify whether we will win in the SVO by May 9 next year (according to many military personnel, this is not enough time for a complete Victory), whether the hostilities will simply end, as some of Vladimir Putin's associates predict, or whether the SVO will move to some other form and stage.

Another source in the Presidential Administration admitted to us that he “does not want any more Victory Days like this one.” “There were and are a lot of nerves. Just look at the problems that the enemy has created for Moscow with its drones. It is worth mentioning that Vladimir Vladimirovich will be protected by a consecrated bulletproof vest and several crosses at once during the parade. It is unpleasant to celebrate the holiday in such a nervous atmosphere,” he complained.

It is worth saying that not everyone in the Kremlin shares this opinion. “We live in tragic, but the best times for modern Russia. And if someone complains and wants some changes, then I simply feel sorry for such a person,” noted another of our interlocutors in the Presidential Administration.

https://t.me/kremlin_secrets/5641

15,611 posted on 05/09/2025 6:48:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15608 | View Replies]

To: marcusmaximus
This is a 1.5 h video from the 9th of May by The Telegraph
In full: Russia Victory Day parade 2025 - commentary from Dom Nicholls and Oksana Pyzik

Russia marks 80th anniversary of Victory Day with a military parade in Moscow's Red Square and The Telegraph will be providing live event commentary with Dom Nicholls, Associate Editor, and Oksana Pyzik, University College London, from 8am.

Donald Trump has urged a 30-day ceasefire in Ukraine as Russia gears up for its parade. The US president threatened further sanctions if both parties do not respect a ceasefire, adding that he will be available at “a moment's notice” for negotiations. “This ceasefire must ultimately build toward a Peace Agreement,” Mr Trump wrote on Truth Social. “It can all be done very quickly, and I will be available on a moment's notice if my services are needed.” Mr Trump's comments come ahead of Russian President Vladimir Putin's parade in Moscow, an event the Kremlin hopes will rally patriotism at home and project strength abroad.

Officials promise that commemorations this year - the 80th anniversary of the Soviet victory over Nazi Germany - will be the “biggest” ever. More than 20 foreign dignitaries, including China's Xi Jinping and Slovakia's Robert Fico, are expected to attend. Putin unilaterally ordered a three-day truce for the duration of the holiday, starting Thursday, but Ukraine has accused Moscow of violating it hundreds of times. Dismissing the truce as a sham, Ukraine has called the events in Russia a “parade of cynicism” and warned that it cannot guarantee the safety of visiting world leaders.

https://www.youtube.com/live/YMfnk-j42Rs
1h 57m video, but increase the speed. The person in the open car is the Muscovian Defense Minister Andrei Belousov, march, equipment and vehicles from 1 h 11m, “There is the officer who ate all the pie!” 1:14:10, hugging Nork generals 1:34 (More medals than I have.)

Putin leads Victory Day celebration in Moscow under tight security
Russia said 27 world leaders were attending the event, but it was the presence of China's leader, alongside Putin and more than 100 Chinese soldiers marching on Red Square, that stood out.
Russia's pivot to the east was underlined by military contingents from North Korea, Vietnam and Mongolia, although the North Koreans did not march during the parade.

Thousands of North Koreans have fought against Ukrainian forces in Russia's Kursk region and Putin made a point of personally greeting some of them on Red Square. mHe hugged three-star general Kim Yong-bok, considered the commander of North Korean forces deployed in Russia as well as deputy chief of the army's general staff. North Korea's Kim Jong Un visited the Russian embassy in Pyongyang to highlight his country's increasing ties with Moscow.

https://www.bbc.com/news/articles/cly3807exyno

15,612 posted on 05/09/2025 8:38:05 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15586 | View Replies]

To: BeauBo

An attack would have caused WWIII!


15,613 posted on 05/09/2025 2:30:22 PM PDT by scan_complete
[ Post Reply | Private Reply | To 15603 | View Replies]

To: JonPreston

Fundamentally, and deeply dishonest of you.

Again.


15,614 posted on 05/09/2025 6:51:23 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15610 | View Replies]

To: BeauBo
Here you go.

This is the Tweet from Dimko Zhluktenko, an insane Ukranian. Just click the link

Do you mind if I post this back to you every time you lie about it?

************

*******

We MUST BOMB Military Parade in Moscow.



We will.

Russian forces ruin Ukrainian homes and families daily under the guise of hunting "NATO mercenaries."

Can you name a single reason why Ukraine shouldn't strike these countless, legitimate military targets in Moscow?

It’s WAR.

pic.twitter.com/GRgVM5p3d2— Dimko Zhluktenko 🇺🇦⚔️ (@dim0kq) May 7, 2025


15,615 posted on 05/09/2025 7:07:13 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15614 | View Replies]

To: BeauBo
Here's the culprit

Is he a friend of yours, VaxxBoy?


15,616 posted on 05/09/2025 7:13:29 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15614 | View Replies]

To: gleeaikin; FtrPilot
Russian Offensive Campaign Assessment, May 9, 2025

US President Donald Trump explicitly called for a longer-term ceasefire in Ukraine that would precede peace negotiations — a sequence that Ukraine has consistently supported and that Russia has consistently rejected. Trump stated on May 8 that the United States calls for a 30-day unconditional ceasefire that “must ultimately build toward a peace agreement.”[1] Trump noted that he is committed to securing a Ukrainian-Russian peace with the Europeans. US Vice President JD Vance stated on May 8 that Russia asked for “too much” because Russia perceives that it is winning the war on the battlefield.[2] Vance stated that Russia cannot expect Ukraine to cede territory to Russia that Russian forces have not seized — in reference to Russian President Vladimir Putin's demand that Ukraine cede territory in eastern and southern Ukraine that Russian forces do not currently occupy.[3] Vance reiterated that the United States wants Ukraine to remain a sovereign country. Ukrainian President Volodymyr Zelensky stated on May 9 that he is working together with European states to achieve a ceasefire at least 30 days long.[4] Zelensky reported that his May 8 phone call with Trump demonstrated that the United States, Ukraine, and Europe are “on the same page” about the necessity of a full ceasefire. The Kremlin has consistently rejected Ukrainian and American proposals for 30-day ceasefires while blaming Ukraine for the lack of progress towards peace negotiations.[5]

Ukrainian resistance with Western support has prevented Russian forces from seizing any of their self-identified objectives in Ukraine over the past year, depriving Russian President Vladimir Putin of significant battlefield successes to celebrate on Victory Day. Putin did not discuss the battlefield situation in Ukraine during Russia's Victory Day celebrations in Moscow on May 8 and 9 but claimed that all of Russia supports Russian servicemembers fighting in Ukraine.[6] Russian forces have not seized any significant towns in Ukraine since the seizure of Avdiivka in February 2024, and the only mid-sized settlement that Russian forces have seized in Ukraine since December 2024 is Velyka Novosilka (pre-war population of 5,000).[7] Ukrainian sources previously reported that Russian forces were trying to seize Pokrovsk, Chasiv Yar, Toretsk, and the remaining area of Luhansk Oblast and advance into Dnipropetrovsk Oblast by Victory Day on May 9.[8] Russian forces did not accomplish any of those objectives, and have in fact been trying to seize Pokrovsk, Chasiv Yar, and Toretsk for roughly a year.[9]

Ukrainian long-range strikes and improved integration of tactical drone operations with defensive operations and counterattacks — all enabled by Western military support — have slowed, and in some places stalled, Russian offensive operations in Ukraine. Ukraine's successful integration of Ukrainian drone innovators and operators with ground forces appears to have stalled Russia's offensive against Pokrovsk and Toretsk in 2024 and early 2025.[10] Ukrainian long-range strikes against Russian ammunition depots, defense industry facilities, and oil and gas infrastructure have at times compromised Russia's ability to supply frontline units and have compounded the rising costs of Russia's war against Ukraine.[11] Ukrainian forces have also intentionally exacerbated other Russian vulnerabilities over the last year, including exacerbating Russia's shortage of operational reserves by launching the incursion into Kursk Oblast in August 2024 and forcing the Russian military to redeploy troops from other frontline areas to defend against the incursion.[12]

Delegations from 35 countries and the Council of Europe visited Lviv City on May 9 in celebration of Europe Day in Ukraine.[32] Ukrainian Prime Minister Denys Shmyhal stated that the delegations would hold a meetings of EU foreign ministers and the Core Group on the Establishment of a Special Tribunal for the Crime of Aggression against Ukraine.[33] The Core Group announced on May 9 the creation of a special tribunal within the Council of Europe to investigate and prosecute Russian officials for the crime of aggression against Ukraine.[34]

Ukraine's European allies continue to support the Ukrainian military and defense industrial base (DIB). The EU, Denmark, France, and Italy agreed on May 9 to transfer one billion euros (roughly $1.1 billion) from proceeds from frozen Russian assets to the European Peace Fund to purchase weapons from the Ukrainian DIB for the Ukrainian military.[35] Ukrainian Prime Minister Denys Shmyhal announced that the EU also allocated 600 million euros-worth (roughly $675 million) of artillery and ammunition to Ukraine and more than 200 million euros (roughly $225 million) to strengthen Ukrainian air defenses.[36] Ukrainian Foreign Minister Andriy Sybiha noted on May 9 that the EU has committed to supply Ukraine with over 1.35 million artillery shells in 2025.[37]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-9-2025

15,617 posted on 05/09/2025 11:31:45 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15591 | View Replies]

To: blitz128; BeauBo
At least two soldiers facing investigations and public accusations for war crimes in Ukraine were on the podium next to a war criminal Putin.

Vladislav Golovin, a marine from the 810th Guards Naval Infantry Brigade of the Black Sea Fleet,was behind Putin's back.

He was awarded the title of Hero of the Russian Federation in 2022. The 810th Guards Naval Infantry Brigade has been repeatedly mentioned in investigations into the commission of war crimes in Ukraine – in particular, the execution of prisoners and participation in the storming of Mariupol.

Golovin was a participant in the killings of civilians in Mariupol.

Akhra Avidzba, commander of the so-called interbrigade “Pyatnashka”, was next to him on the podium. “Pyatnashka” is an armed formation fighting on the side of Russian-backed separatists in eastern Ukraine.

The interbrigade and its commander are accused of committing a number of serious crimes: looting, abductions, torture of Ukrainian prisoners of war and illegal participation in hostilities in Donetsk region

https://bsky.app/profile/antongerashchenko.bsky.social/post/3loqhjhyoh22p

15,618 posted on 05/09/2025 11:42:23 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15612 | View Replies]

President Macron, PM Starmer, PM Tusk, Chancellor Merz have arrived in Kyiv today. Welcome! Thank you for your unwavering support for Ukraine!

https://bsky.app/profile/antongerashchenko.bsky.social/post/3loscz5ss7226
30s video


15,619 posted on 05/09/2025 11:46:03 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15618 | View Replies]

To: PIF; GBA



15,620 posted on 05/09/2025 11:50:37 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15556 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,581-15,60015,601-15,62015,621-15,640 ... 19,421-19,424 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson