Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,101-16,12016,121-16,14016,141-16,160 ... 21,121-21,125 next last
To: blitz128; AdmSmith; PIF; FtrPilot; BeauBo; marcusmaximus

Since comments here have slowed down a bit, I had time to check other sites. I entered Moscow in the Search bar and found interesting posts. The best was a surprise successful effort by Marco Rubio to embarrass both Putin and Venezuela’s illegal president Maduro, before all the visitors at Putin’s big WW2 celebration in Moscow.

https://freerepublic.com/focus/f-news/4315716/posts

Five Venezuelan freedom fighters had been sheltered at Argentina’s embassy in Venezuela for more than a year. Madura had surrounded that embassy with forces to prevent their escape. Rubio had the imagination and guts to plan a successful rescue right when all of Putin’s visitors were being shown how impressive his military is. Maduro and the Cuban representative were both there to be impressed. I’m sure they were, but not in the way Putin had planned.

Over all in the past month listed at “Moscow” are around a dozen articles describing the discomfort and embarrassment Ukraine has been inflicting with massive
drone attacks. With all the visitors for the celebration, closing most or all Moscow airports has been an especially effective annoyance to Putin’s plans. This March post regarding Ukraine’s impressive and record 337 drone attack gave Putin plenty to worry about as he planned his big extravaganza.

So, if you are not finding enough at this thread to hold your interest, Search Moscow, or other topics like Putin, Russia, Ukraine, or Crimea.

https://freerepublic.com/focus/f-news/4303500/posts


16,121 posted on 05/24/2025 6:42:45 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16117 | View Replies]

To: JonPreston
"Please source your material and resend"

It's all public information available from many different sources.

If you wish to dispute any of it, you can point out what, and explain why.

I'll be happy to respond.

16,122 posted on 05/24/2025 6:48:28 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 16088 | View Replies]

To: blitz128; AdmSmith; BeauBo; marcusmaximus

“...the Soviet Union was never actually dissolved, that’s the new talking point”

That would explain why the most recent post at “Moscow” is about the erection of a new statue of Comrade Stalin. This statue has drawn mixed reactions. Some are happy to follow Putin’s lead in celebrating the Soviet/Stalin era. Others still remember the terrible trials Stalin used to execute tens of thousands of Russians, and send even more to rot in Siberian Gulags.

https://freerepublic.com/focus/f-chat/4318467/posts


16,123 posted on 05/24/2025 6:56:01 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16117 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russians Move Thousands of Troops to Polish Border in an “Exercise ]

Today [ May 23 ], there are interesting updates from Poland. Here, the Polish government has taken serious actions against the growing threat from Russia. After Russian sabotages and orchestrated pressure on the border with Belarus, Poland has stepped up its defensive efforts, mobilizing thousands of soldiers, and launching a massive rearmament.

First of all, Poland has just closed the Russian consulate in Krakow, after investigators uncovered evidence linking Moscow to a massive fire that destroyed a huge shopping center in Warsaw. The act, widely seen as sabotage, represents the most blatant escalation yet in Russia’s hybrid campaign against Poland, and has become the tipping point for a full-spectrum Polish defense mobilization.

This sabotage is the latest, but not the only chapter in a broader pattern of hybrid warfare targeting Poland. One key front in this has been the Polish Belarusian border. Since spring 2024, illegal migrant crossings have surged, with 7,100 cases recorded in May 2024 compared to 1,900 in May the year before. Belarus continues to fly in migrants from third countries, equip them with tools like ladders and bolt cutters, and direct them toward the Polish border.

These incursions, clearly orchestrated by Belarusian security forces, often turn violent: migrants have thrown rocks, assaulted border guards, and in one tragic case, fatally stabbed a Polish soldier. Polish authorities emphasize that these migrants are not arriving unassisted or randomly; they are pawns in an ongoing campaign designed to destabilize Poland and retaliate against EU sanctions. As border pressure intensifies, the nature of incidents has grown more aggressive, pushing Poland to escalate its response.

The tension peaked several days ago with the Russia’s announcement of joint military exercises with Belarus, right near the Polish border in September 2025. These drills historically involve large troop movements, up to 200,000 in 2021, and in that case, preceded the full-scale war against Ukraine.

This year’s iteration will include rapid reaction and logistics training, raising serious concerns. Ukrainian President Volodymyr Zelensky warned that these exercises could be a pretext for new attacks, possibly targeting Ukraine, Lithuania, or even Poland.

Poland’s response has been swift and multifaceted. Diplomatic ties with Russia are being severed, starting with the closure of the Krakow consulate. The border is being reinforced with new layers of defense: high fences, anti-infiltration trenches, concrete bunkers, and surveillance networks including drones, thermal imaging, and AI-powered cameras.

Zero-tolerance policies are now in place for any border incursion. In parallel, quiet mass mobilization has begun; a discreet, but systematic expansion of military readiness through increased recruitment, civilian training programs, and nationwide defense exercises without formally declaring a state of mobilization.

Poland is also undergoing a historic rearmament. Its military has grown rapidly, now NATO’s 3rd largest and the largest in Europe. From over 160,000 soldiers today, Poland aims to reach 300,000 in the near term, and potentially 500,000 in the long term. Prime Minister Donald Tusk has announced plans to train 100,000 civilian volunteers annually, starting in 2027. This mobilization effort is underpinned by a massive acquisition program of cutting-edge weaponry.

Key purchases include 1,000 K2 Black Panther tanks, 672 K9 Thunder howitzers, and 48 FA-50 fighter jets from South Korea. Additionally, 250 M1A2 Abrams tanks and 500 HIMARS rocket launchers from the United States.

Poland has also ordered 32 F-35A fifth-generation stealth fighters, 96 Apache AH-64E helicopters, and 24 Turkish Bayraktar TB2 drones. These platforms will not only modernize Poland’s force structure, but also give it a powerful deterrent edge. The rapid procurement pace, combined with local production of key systems, signals Poland’s determination to prepare for any escalation scenario.

As part of its strategic posture, Poland is also investing in military infrastructure, particularly in critical areas like the Suwałki Gap. This vulnerable corridor between Poland and Lithuania, flanked by Belarus and Russia’s Kaliningrad exclave, is considered one of NATO’s softest points. Fortifying it with road upgrades, dual-use logistics networks, and anti-mobility barriers is now a top priority.

Overall, Poland, with its proximity to both Belarus and Russia and its historical experience with aggression from the east, is treating the current threat with the utmost seriousness. Over the past months, that threat has materialized in the form of violent border pressure, internal sabotage networks, and hostile military posturing. Poland’s only viable response is to fully mobilize fortify, its defenses, support Ukraine, and prepare for whatever comes next from Russia.

https://www.youtube.com/watch?v=tN-kWypQADo


16,124 posted on 05/24/2025 6:56:48 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16114 | View Replies]

To: gleeaikin

That thread is completely hijacked by Putin trolls


16,125 posted on 05/24/2025 6:58:59 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16121 | View Replies]

To: BeauBo
What do you think, June 11th or 12th, for Putin to rack up a million Russian casualties?

20, 170 is needed, assume 800 - 1,200/day => 16 - 25 days or June 9th to 18th, so you might be right.

June 11:
1184 BC Trojan War: Troy is sacked and burned, according to calculations by Eratosthenes,
1578 England grants Sir Humphrey Gilbert a patent to explore and colonize North America
June 12:
28 Roman General Gaius Carrinas' triumphant procession through Rome, awarded for fighting in Gaul
16,126 posted on 05/24/2025 7:01:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16118 | View Replies]

To: JonPreston; PIF; BeauBo
"Didn't I tell ya?
DIDN'T I TELL UA??

'US Vice President J.D. Vance:
"The era of American global hegemony is over.' "

Those are your poster's words, not Vance's.

16,127 posted on 05/24/2025 7:04:25 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 16093 | View Replies]

To: PIF
Russian-led cybercrime network dismantled in global operation
Arrest warrants issued for ringleaders after investigation by police in Europe and North America

European and North American cybercrime investigators say they have dismantled the heart of a malware operation directed by Russian criminals after a global operation involving British, Canadian, Danish, Dutch, French, German and US police.

International arrest warrants have been issued for 20 suspects, most of them living in Russia, by European investigators while indictments were unsealed in the US against 16 individuals.

Those charged include the alleged leaders of the Qakbot and Danabot malware operations, including Rustam Rafailevich Gallyamov, 48, who lives in Moscow and Aleksandr Stepanov, 39, AKA JimmBee and Artem Aleksandrovich Kalinkin, 34, AKA Onix, both of Novosibirsk, Russia, the US Department of Justice said.

https://www.theguardian.com/technology/2025/may/23/russian-led-cybercrime-network-dismantled-in-global-operation

16,128 posted on 05/24/2025 7:09:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16125 | View Replies]

To: BroJoeK
It's all public information

It's funny you intentionally omit the information from your windy posts. It's not a good look, Zeeper.

16,129 posted on 05/24/2025 8:14:55 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16122 | View Replies]

To: PIF; AdmSmith; FtrPilot; blitz128

Yesterday I posted an interesting video at comment #16,091 about Lithuania’s plans to fortify it’s borders with Kaliningrad and Belaruse, as well as cooperate with Poland to improve the traffic between Poland and Lithuania and protection in the vulnerable Suwalki Gap. The link below which I posted at my previous comment has good map explanations about Lithuania’s plans which also make it easy to understand what Poland will be doing to complement that work.

https://www.youtube.com/watch?v=A57My6gssr4 [3.5 min.]

It is gratifying to see all the steps these two countries are taking to ensure that Putin cannot succeed with the kind of walk-over he did to Ukraine in 2014. They will be much better prepared if Putin tries anything like his move on Ukraine in Feb. 2022. Ukraine’s success in driving Russia back that year was a great tribute to courage and creativity, but not so much to advance preparation so far as I could see. Trump has urged Europe to increase spending on security preparation. It looks like Putin is doing a good job of making that happen. I saw in this comment that Poland is getting 250 Abrams tanks. In 2023 I saw they were planning to order 500 Abrams from us. Did they scale down the order as the drone warfare picture developed, or is this the first or second half of that order which is mentioned here today?


16,130 posted on 05/24/2025 8:24:49 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16124 | View Replies]

To: BroJoeK; PIF; BeauBo; blitz128
🍈

To those Bitter Clinging arguing that the Soviet Union still exists, take your argument to Grok 3, Elon Musk's latest AI.


16,131 posted on 05/24/2025 8:26:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16127 | View Replies]

To: gleeaikin

As much as pitin “loves his history”,Russian mir cares not for anything but their version. So I stand by the idea that pitin rejects that the Soviet union was actually desolved.

Perhaps pitin should go back far enough and decide that Russia still belongs to the Mongolians 😎🤔


16,132 posted on 05/24/2025 8:36:16 AM PDT by blitz128
[ Post Reply | Private Reply | To 16123 | View Replies]

To: mir
And here comes Low IQ banging his head against the wall 😎🤔
16,133 posted on 05/24/2025 8:38:53 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16132 | View Replies]

To: blitz128; PIF
🍈

So I stand by the idea that pitin rejects that the Soviet union was actually desolved.

I think you mean dissolved

16,134 posted on 05/24/2025 8:41:22 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16132 | View Replies]

To: BeauBo
President Trump says he will do it. I believe him. Bone-crushing, Trump-style sanctions.

BoBo, Trump not only DIDN'T PLACE BONE-CRUSHING SANCTIONS on Russia, instead he leveled 50% tariffs on the EU.

Looks like you got that one wrong, like so many others


16,135 posted on 05/24/2025 10:59:45 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15874 | View Replies]

To: PIF; FtrPilot; BeauBo; All

Ukraine expecting mass attack tonight by Russia with aviation and marine-launched cruise missiles, ballistic missiles and 300+ Russian drones.


16,136 posted on 05/24/2025 1:19:40 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 16125 | View Replies]

To: marcusmaximus

All Ukraine must leave the country now with immediate effect


16,137 posted on 05/24/2025 2:55:04 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16136 | View Replies]

To: marcusmaximus; FtrPilot; PIF; blitz128

⚡We are airborne

10 Tu-95M nuclear capable bombers of the Russian Airforce are in the air.

Multiple ballistic launches and Geran-2 kamikaze drones already in active over Ukrainian airspace.

The night is still young...🔥 pic.twitter.com/PnBxgYnceH— Spetsnaℤ 007 🇷🇺 (@Alex_Oloyede2) May 24, 2025


16,138 posted on 05/24/2025 4:06:03 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16136 | View Replies]

To: PIF; FtrPilot; BeauBo; All

Could be the biggest air attack by Russia since the war started.


16,139 posted on 05/24/2025 4:18:54 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 16136 | View Replies]

To: PIF; FtrPilot; BeauBo; All
Russian government aircraft fleeing Moscow right now.



16,140 posted on 05/24/2025 4:23:26 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 16139 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,101-16,12016,121-16,14016,141-16,160 ... 21,121-21,125 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson