Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,061-16,08016,081-16,10016,101-16,120 ... 19,281-19,284 next last
To: AdmSmith; FtrPilot

Russian Offensive Campaign Assessment, April 13, 2025

Kremlin Spokesperson Dmitry Peskov said that ongoing US-Russian negotiations are unlikely to result in “lightning-fast results,” contrary to US President Donald Trump’s stated objective of achieving a general ceasefire and lasting peace agreement in Ukraine in the near future. Peskov told Kremlin journalist Pavel Zarubin on April 13 that “everything is moving very well” regarding US-Russian bilateral talks and discussions about the war in Ukraine but that there will likely not be immediate results.[1] Russian Ministry of Foreign Affairs (MFA) Second Department of Commonwealth of Independent States (CIS) Director Alexei Polishchuk gave an interview to Russian state media group Rossiya Today (RT) and stated that Russia is willing to engage in negotiations that “take into account the modern realities” of the war and eliminate the “root causes” of Russia’s war in Ukraine.[2] Russian officials have repeatedly claimed that any peace process in Ukraine must address these so-called “root causes.”[3] Russian Foreign Minister Sergey Lavrov previously defined “root causes” as NATO’s alleged violation of obligations not to expand eastward and Ukraine’s alleged discrimination against Russian-speaking minorities in Ukraine.[4] These so-called ”root causes” are a reference to Russia’s pre-war demands that effectively amount to Ukraine’s full capitulation and the installation of a pro-Russian government in Ukraine.[5] Peskov’s and Polishchuk’s comments also reflect the Kremlin’s continued rejection of President Trump’s stated approach of first establishing a ceasefire and then negotiating a broader peace agreement and the Kremlin’s commitment to war aims that are incompatible with President Trump’s goal of achieving a lasting peace in Ukraine.

It is unclear if Russian officials will agree to any meaningful monitoring mechanisms, however, as Russian officials continue to reject the possible future deployment of a European peacekeeping contingent to Ukraine.[9] Polishchuk responded to a question about whether Russia will agree to sending peacekeepers to Ukraine on April 13 and stated that peacekeeping deployments are “not on the agenda.”[10] Polishchuk insinuated that Russia and Ukraine must conclude a peace or ceasefire agreement before considering the issue of peacekeepers and claimed that the French- and British-led “Coalition of the Willing” is attempting to intervene in Ukraine by forming what it is calling a “reassurance force.” Polishchuk accused the Organization for Security and Co-operation in Europe’s (OSCE) Special Monitoring Mission to Ukraine of falsifying reports on Russian violations of the Minsk agreement between 2014 and 2022, despite indications that Russia itself maintained significant influence over the OSCE and seriously hindered the OSCE’s monitoring and enforcement mandates during this time.[11] The Kremlin’s ongoing refusal to engage with US and European proposals to establish a peacekeeping force in Ukraine and Polishchuk’s accusation that the OSCE has previously acted in Ukraine’s — and not Russia’s — favor underscores the Kremlin’s continued unwillingness to accept any kind of monitoring mechanisms that could undermine Russia’s ability to attack Ukraine again in the future.

Ongoing milblogger complaints about the Russian military’s conduct of the war in Ukraine reinforce ISW’s assessment that Russian tactics will degrade Russia’s manpower and materiel resources and contribute to slowing Russian advances along the frontline. A Russian milblogger and former Storm-Z instructor claimed on April 12 that the Russian military command is using a “thousand cuts” tactic against Ukraine to the detriment of Russian forces and complained that deploying poorly equipped and poorly trained Russian infantry to attack Ukrainian defensive positions only results in marginal gains and heavy losses.[23] The milblogger argued that the Russian military command is attempting to present high manpower and materiel losses as necessary by falsely portraying the preceding combat engagements as evidence of Russia‘s coordinated “grinding” down of Ukrainian defenses.[24] The milblogger claimed on April 12 and 13 that the Russian military command is ignoring the fact that Russian forces are facing shortages of materiel necessary for offensive operations, which contributes to issues conducting assaults and to the failure of small group assaults along the frontline in Ukraine.[25] The milblogger claimed that frontline Russian commanders are under significant pressure from their superiors to conduct more infantry assaults, do not have sufficient time to plan new assault routes, and that some frontline commanders order assaults simply to be able to report something back to their superiors. ISW previously assessed that these grinding assaults will likely degrade available Russian manpower and materiel significantly enough that Russian forces will have to decrease offensive tempo on lower-priority sectors of the front.[26] The milblogger speculated that Russian forces are in a self-perpetuating cycle, where poorly trained infantry killed or injured in failed assault attempts are replaced with similarly poorly trained infantry, who are again sent into doomed assaults.[27] The milblogger’s claims reflect the general trend of slowing Russian advances along the frontline recently and highlight some of the critical issues that Russian forces will have to address if they intend to make significant territorial gains or conduct more sophisticated offensive operations in Ukraine in the future.[28]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-13-2025

16,081 posted on 05/23/2025 5:40:44 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16079 | View Replies]

To: BeauBo
🇺🇦 UA drone maker Skyeton is developing a new airborne electronic reconnaissance system with Denmark’s Quadsat, using the ACS-3 Raybird UAV.

The system will locate enemy radars, EW gear & RF sources—stealthily & in real time.

Its release is set for Drone Show Denmark 2025.

https://x.com/NOELreports/status/1925833228373328008


16,082 posted on 05/23/2025 5:52:08 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 16080 | View Replies]

To: BeauBo
After some wavering, the US joined other G7 finance ministers in a statement that condemns Russia's invasion of Ukraine.

"Russia’s sovereign assets in our jurisdictions will remain immobilized until Russia ends its aggression and pays for the damage it has caused to Ukraine."

https://x.com/Osinttechnical/status/1925795707073548655


16,083 posted on 05/23/2025 5:58:44 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 16082 | View Replies]

To: FtrPilot

The whole attack was designed to demonstrate UKF's ability to shoot down ruzzian aircraft flying over the Black Sea.

This shoot-down will reverberate through the ruzzian fighter community.

My guess is that ruzzia has been flying HVAP (high value asset protection) missions over & near the bridge because some of the surface to air systems have been moved to moscow for the May 9th parade.

Perhaps UKF are planning another attack on May 9th...release the Taurus.

16,084 posted on 05/23/2025 7:11:42 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16083 | View Replies]

To: JonPreston; FtrPilot; gleeaikin; AdmSmith; PIF
JonPreston's frequently reposted political cartoon is out-of-date, if it was ever accurate.

Pres. Trump's "One Big Beautiful Bill", plus other actions taken, contain several family-friendly features, including:

  1. "No Tax on Tips" -- especially helpful for hospitality, personal services and gig workers.

  2. "No Tax on Overtime" -- especially helpful for all hourly workers.

  3. "No Tax on Social Security" -- thank you Pres. Trump.

  4. No tax on interest for car loans on US made cars.

  5. Reduced taxes for small businesses, maintains lower tax rates for all businesses.

  6. Increased child tax credits to $2,500.

  7. $1,000 - $5,000 government supported, tax deferred annual saving account for newborns.

  8. Elimination of fraud & abuse in Medicaid, SNAP & Social Security.

  9. Numerous RFK, Jr., M.A.H.A. related proposals.

  10. Elimination of all "woke" nonsense from all government supported activities.

  11. $50 billion for border security and deportations.

  12. $1 trillion for national defense.
All of these proposals, and many more, are aimed at improving the lives, prosperity, health & safety of American families.

As for Ukrainian families, it's not now clear how much, if any, US aid is still in the pipeline, but it is known that Europeans and other Western allies are increasingly stepping up to fill in whatever gaps have opened up.

In the meantime, Russian forces continue to advance at the rate of a few square miles per day and a cost of over 1,000 Russian casualties per day.

16,085 posted on 05/23/2025 7:22:33 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 16051 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...
Russian Offensive Campaign Assessment, May 22, 2025

Russian President Vladimir Putin is fostering the formation of an informal state ideology based on Russian nationalism that positions Russia in opposition to the West as part of ongoing efforts to militarize and unify Russian society. Putin stated on May 22 at a likely highly scripted award ceremony that “strong family foundations” and “traditional values” support Russia's “1,000-year-old statehood.”[1] Putin emphasized that Russia's “most important” task is to preserve its people, culture, and spirituality. A Russian Orthodox priest who received an award during the ceremony thanked Putin for protecting Russian traditional culture, spirituality, and language. The priest noted that Russia's celebrations of its contributions to victory in the Second World War teach Russian youth and those in the “Russkiy Mir” (”Russian World”) to defend Russia and love Russia's culture and spiritual foundations. (The “Russian World” is a Kremlin-promoted geopolitical concept with amorphous parameters that broadly encompass those who live outside of Russia's borders but relate in some vague way to Russian language, culture, Orthodoxy, and media). Russian State Historical Museum General Director and awardee Alexei Levikin claimed that many countries hostile to Russia are basing their policies and ideologies on the falsification of historical events and facts. A martial arts school director who received an award claimed that Russia always proves that its fighters are the best on the battlefields and in sports arenas.

Putin notably promoted Russian nationalism by emphasizing Russia's spirituality and thousand-year history and by giving only a Russian Orthodox priest — but no representatives of other faiths — an award, despite the fact that the Russian state formally regards Russian Orthodoxy, Islam, Judaism, and Buddhism as Russia's “traditional” religions.[2] Putin has previously highlighted ethnic and religious minorities’ contributions to Russia at high profile events and has often promoted a civic Russian identity and nationalism.[3] Putin's departure from this rhetoric at the highly staged event on May 22 may be an attempt to appease the increasingly pro-war Russian ultranationalist community. Putin is also attempting to use the awardees’ statements to reinforce the creation of an informal state ideology predicated on perpetuating the belief that the West is determined to defeat Russia, thereby justifying a future military conflict against the West to the Russian public.[4] Putin declared 2025 the “Year of the Defender of the Fatherland,” and the development of an informal Russian nationalist ideology provides an ideological foundation for the ongoing Kremlin effort to develop a new cadre of loyal elites that includes selected veterans of Russia's full-scale invasion of Ukraine.[5] Putin will likely expand efforts to unify Russian society against the perceived threat of the West and to develop an elite class of militarized nationalists in order to ensure that any successor will embody similarly aggressive and dangerous ideals that perpetuate eternal conflict with the West and NATO.

Russian Investigative Committee Head Alexander Bastrykin — one of the most outspoken Russian ultranationalists in Putin's inner circle — expressed support for the inclusion of an informal state ideology based on Russian nationalism in the Russian Constitution. Russian State Duma Deputy Speaker Pyotr Tolstoy stated on May 19 at the St. Petersburg International Legal Forum that Russia may change its constitution in the future.[6] Duma Committee on State Building and Legislation Head Pavel Krasheninnikov later stated at the forum that the Russian Constitution “meets current realities” and does not need amending, however.[7] Kremlin Spokesperson Dmitry Peskov stated on May 19, in response to Tolstoy, that changing the constitution is “not on the [Kremlin's] agenda.”[8] Bastrykin claimed in an interview with Kremlin newswire TASS published on May 22 that Russia is built on traditional values, such as patriotism, citizenship, service to the Fatherland, and a strong family, and that these traditional values should underpin Russia's “national idea.”[9] Bastrykin further claimed that Russia should enshrine this “national idea” in its constitution. Bastrykin emphasized Russia's need to protect and preserve its “historical heritage” through legal frameworks. Bastrykin routinely publicly expresses interest in an informal Russian state ideology predicated on Russian ethno-religious nationalism and opposition to the West, in contrast to other senior Russian officials.[10] The Russian Constitution notably forbids the adoption of a formal state ideology.[11] Peskov stated on May 22 that it is difficult to comment on proposals to amend the Russian Constitution because the Kremlin does not have the specifics of such proposals — a departure from his May 19 statement apparently dismissing changes to the constitution.[12] Kremlin officials most recently leveraged Victory Day, Russia's largest holiday that commemorates the Soviet Union's contributions to the Second World War, to promote a new informal state ideology based on Russian unity in the face of opposition from the West.[13] The Kremlin is likely accelerating its promotion of this ideology to prepare the domestic population for a future military conflict against the West. Bastrykin is likely spearheading efforts to formally enshrine Russian nationalist ideology in the constitution as one of the most powerful and influential ultranationalists within the Kremlin elite.

Russian authorities are renewing their years-long narrative rejecting the legality of the dissolution of the Soviet Union in 1991, possibly to deny Ukrainian and Belarusian sovereignty and independence in the future. Russian State Duma Committee on the Protection of the Family, Fatherhood, Motherhood, and Childhood Head and member of the Communist Party Central Committee Nina Ostanina stated on May 22 that Duma deputies are ready to raise the issue of the alleged illegality of the dissolution of the Soviet Union.[14] Ostanina agreed with Russian Presidential Advisor Anton Kobyakov's May 21 claim that the Soviet Union's founding body was not involved in the dissolution of the Soviet Union and that, therefore, the Soviet Union still legally exists.[15] Ostanina further claimed that the dissolution of the Soviet Union was illegal because “no one gave authority” to then Belarusian Parliament Chairperson Stanislav Shushkevich, then Russian Soviet Federative Socialist Republic President Boris Yeltsin, and then Ukrainian President Leonid Kravchuk to sign the December 1991 Belovezha Accords, the internationally recognized document in which the Soviet republics of Ukraine, Russia, and Belarus agreed to dissolve the Soviet Union.[16] Russian authorities have intermittently revived false narratives about the illegality of the Soviet Union's dissolution and calls to reestablish the Soviet Union since at least 2014, and promoted this informational effort in 2021 and 2023.[17] The Kremlin has been pursuing its strategic effort to de facto annex Belarus through the framework of the Union State of Russia and Belarus and consistently denies Ukrainian sovereignty.[18] Russian officials, including Russian President Vladimir Putin and Investigative Committee Head Alexander Bastrykin, have frequently invoked the “trinity doctrine” — the ideological concept suggesting that Russians, Belarusians, and Ukrainians are a “triune” and forcibly separated people.[19] The Kremlin may be instructing lower-level officials to reinject the narrative about the allegedly illegal dissolution of the Soviet Union into the Russian information space in order to set conditions for the Kremlin to withdraw its recognition of Ukraine and Belarus as independent states in the future and call for a united Russian, Belarusian, and Ukrainian state. Russian officials have notably not acted upon past calls for the reestablishment of the Soviet Union, and the most recent iteration of this information campaign is similarly unlikely to have any near-term effects.

Russian authorities and state media continue to publicly question the legitimacy of the Ukrainian negotiating team and the Ukrainian government, likely to further efforts to reject and delay negotiations and to set conditions to renege on any future peace agreement with Ukraine. Russian Ministry of Foreign Affairs (MFA) Legal Department Director Maksim Musikhin claimed to Kremlin newswire TASS on May 21 that Ukrainian President Volodymyr Zelensky has “long” lost his “internal” and “external” legitimacy so there “may be problems” with any agreements Zelensky may sign in the future.[20] Musikhin claimed that a person “who has the [Ukrainian] people's mandate” should sign any future agreements and that the Ukrainian people must choose a new leader. Musikhin claimed that the Ukrainian Constitution may grant the head of the Ukrainian Verkhovna Rada the power to sign agreements. TASS also amplified a source allegedly “close to the negotiations” in Istanbul claiming that Ukraine will have to change the members of its negotiating group in order to work on a memorandum for a future peace treaty because the Ukrainian delegation at the recent Istanbul talks had a “shortage of politicians.”[21] The source further questioned the legitimacy of any future Ukrainian negotiating group by claiming that the group may include “spies” working for European states or the United States. Musikhin is reiterating the longstanding false Kremlin claim that Zelensky is not the legitimate leader of Ukraine and therefore cannot sign any agreements with Russia.[22] Musikhin is also repeating Russian President Vladimir Putin's false claim that the Verkhovna Rada is the only legitimate power in Ukraine.[23] Kremlin officials have repeatedly claimed that Ukraine must hold elections for its government to be legitimate even though Ukraine's constitution and law explicitly prohibits elections during periods of martial law and prohibits the Ukrainian government from lifting martial law during invasion by a hostile country.[24] Musikhin’s statements and these Russian state media reports are part of the Kremlin's ongoing efforts to set conditions for Russia to justify its withdrawal from any future peace agreements with Ukraine at a time of Russia's choosing and to support Russia's repeated demand that Ukraine acquiesce to regime change and the installation of a pro-Russian government.[25]

Recent Western reporting provided additional details in a case in which Russian forces executed Ukrainian prisoners of war (POWs) in November 2024, supporting ISW’s assessment that high-level Russian military commanders are likely involved in these executions. CNN reported on May 21 that a Ukrainian intelligence official provided drone footage and intercepted audio in which a Russian commander ordered the execution of Ukrainian POWs and that the footage and audio correspond to a credible report of a Russian execution in western Zaporizhia Oblast in November 2024.[26] CNN reported that it could not independently verify the radio intercept or its link to the execution but noted that a forensic expert and an unnamed Western intelligence official found the audio to be authentic and “consistent with previously documented brutal executions.” Ukraine's Security Service (SBU) told CNN that elements of a “Storm” unit of the Russian 394th Motorized Rifle Regiment (127th Motorized Rifle Division, 5th Combined Arms Army [CAA], Eastern Military District [EMD]) were responsible for the November 2024 executions and at least one other suspected execution. ISW observed additional reporting and footage that indicated that Russian forces captured and disarmed six Ukrainian POWs and executed five at close range near Novodarivka (eastern Zaporizhia Oblast) on November 23, 2024, in violation of international law.[27] UN Special Rapporteur on extra-judicial summary or arbitrary executions Morris Tidball-Binz told CNN that Russian executions of Ukrainian POWs cannot occur at such high numbers or frequency without the orders or consent of the highest Russian military commanders, including Russian President Vladimir Putin. There has been a sharp increase in credible reports and footage of Russian forces executing Ukrainian POWs throughout 2024 and 2025, and ISW continues to assess that Russian military commanders are either complicit in or directly enabling their subordinates to conduct systemic executions in direct violation of international law.[28]

Russian Defense Minister Andrei Belousov confirmed on May 22 Colonel General Andrei Mordvichev’s appointment as Russian Ground Forces Commander.[29] ISW continues to assess that the Kremlin likely appointed Mordvichev to proliferate positional warfare tactics and operational concepts for grinding marginal advances — the main tactics Russian forces used in the Avdiivka-Pokrovsk direction — across Russia's Ground Forces.[30]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-22-2025

16,086 posted on 05/23/2025 7:35:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16031 | View Replies]

They want to return to the Soviet union. i.e. not even this

22NOV2024 Not in favor of the poor: Rosstat’s poverty figures vs. objective reality

In the first half of 2024, Russia's federal statistics agency, Rosstat, reported 13.3 million people living in poverty across the country. Although this is an increase from 2023, it drastically underestimates the actual scale of poverty. For years, the Russian government has manipulated statistics, with Rosstat revising its methods to meet presidential mandates aimed at lowering poverty rates. However, evaluating current data by using the previous methodology reveals a much grimmer picture: by the end of 2023, the number of poor people in Russia was 1.5 times higher than officially acknowledged — ranging from 14.6 to 18 million (up to 12.5% of the population), according to The Insider. Many of those classified as “not poor” struggle to afford basic necessities like clothing and food. Poverty levels surged after the start of the full-scale invasion of Ukraine, and despite enormous government spending, the situation has yet to return to pre-war levels.

Public perceptions of poverty in Russia starkly contrast with official statistics. Russians consider a monthly income below 43,000 rubles to signify poverty. To feel financially secure, the average person believes they would need about 250,000 rubles per month. However, such income levels are out of reach for nearly everyone. As of mid-2024, the top 10% of earners had an average income of 175,600 rubles per month. Meanwhile, the national average per capita income was just 58,191 rubles in the second quarter of 2024 — far below what most consider sufficient for a decent life.

The government, however, sets the poverty line much lower, counting only those earning less than 14,300 rubles per month are registered as “poor” in the state’s poverty statistics. By the end of 2023, Rosstat reported 12.4 million people living in poverty (a record low 8.5%). This figure rose to 13.3 million by mid-2024. Yet just two years earlier, in 2021, the agency reported 17.8 million poor people. Has poverty genuinely decreased since the war began? The short answer is no. Rosstat simply changed its calculations to align with President Putin’s May decrees, which require the government to reduce poverty to below 7% of the population by 2030. The Insider has thoroughly examined these statistical manipulations.

To get a more accurate picture of poverty in Russia, we can apply Rosstat’s previous methodology. While imperfect, it better reflects the purchasing power of ordinary Russians.

read more: https://theins.ru/en/economics/276500


They want to return to this



















16,087 posted on 05/23/2025 7:36:09 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16086 | View Replies]

To: BroJoeK
Please source your material and resend

JonPreston's frequently reposted political cartoon is out-of-date, if it was ever accurate.

Pres. Trump's "One Big Beautiful Bill", plus other actions taken, contain several family-friendly features, including:

  1. "No Tax on Tips" -- especially helpful for hospitality, personal services and gig workers.

  2. "No Tax on Overtime" -- especially helpful for all hourly workers.

  3. "No Tax on Social Security" -- thank you Pres. Trump.

  4. No tax on interest for car loans on US made cars.

  5. Reduced taxes for small businesses, maintains lower tax rates for all businesses.

  6. Increased child tax credits to $2,500.

  7. $1,000 - $5,000 government supported, tax deferred annual saving account for newborns.

  8. Elimination of fraud & abuse in Medicaid, SNAP & Social Security.

  9. Numerous RFK, Jr., M.A.H.A. related proposals.

  10. Elimination of all "woke" nonsense from all government supported activities.

  11. $50 billion for border security and deportations.

  12. $1 trillion for national defense.
All of these proposals, and many more, are aimed at improving the lives, prosperity, health & safety of American families.

As for Ukrainian families, it's not now clear how much, if any, US aid is still in the pipeline, but it is known that Europeans and other Western allies are increasingly stepping up to fill in whatever gaps have opened up.

In the meantime, Russian forces continue to advance at the rate of a few square miles per day and a cost of over 1,000 Russian casualties per day.

16,088 posted on 05/23/2025 9:21:44 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16085 | View Replies]

To: AdmSmith
The Superiority of the Russian Nation
As with most other similar theories, it is based on an exaggerated idea of ​​the role and significance of the Russian nation, which is given the features of a unique and unrivaled subject of history. This thesis has two vectors: internal and external. The internal vector assumes the recognition of the unconditional priority of the nation over the individual. The external vector assumes the recognition of the unconditional superiority of the Russian nation over all other nations and peoples. In its most tragicomic form, this thesis was expressed in the words of one of the main court ideologists, Medinsky, about the presence of an additional chromosome in Russians.

Ukraine as the Holy Grail
Following Solzhenitsyn and other Eurasianists, the Kremlin attaches a special mythical significance to control over Ukraine. The thesis about the impossibility of the existence of the Russian Empire if Ukraine is not part of it, never rationally substantiated by anyone, is accepted as an absolute axiom and is fundamental in all of the Kremlin's geopolitical constructs. In its understanding, Ukraine is worth both the Mass and a “special operation” that can be carried out in the center of Europe as the last and decisive battle.
The right to war

The presence of a sacred goal is a self-sufficient justification for war as a means of achieving this goal. Nietzschean motives are mixed in with this, smacking of a fair amount of Dostoevskyism - am I a trembling creature or do I have the right? In the Kremlin's view, “I can” means both “I have the right” and “I must.”

Russia should repeat the path of Germany - it needs denazification - as the main nation in the world that professes Nazism in its most dangerous manifestations. Pastukhov did not dare to say this, but this is the only way out for Russia.
https://trim-c.livejournal.com/4566781.html

16,089 posted on 05/23/2025 9:24:12 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16087 | View Replies]

To: AdmSmith; PIF; BeauBo; FtrPilot; BroJoeK
HEY ADMSMITH, AS YOU SHAKE YOUR FIST AT PUTIN, YOUR NATION IS BEING DESTROYED.

******

************

Mayors in UK of Sunderland, Birmingham, Brighton and Derby. Who voted for them? pic.twitter.com/Ybueapa3R6— RadioGenoa (@RadioGenoa) May 23, 2025

No EU member state opposes the abolition of duty-free imports from Ukraine , according to Bloomberg.

The sharp increase in exports of cheap Ukrainian goods to the European Union has sparked resistance from farmers, including those from Poland, Hungary and Slovakia, the American…

pic.twitter.com/uY8bpdyPFZ— Sprinter Observer (@SprinterObserve) May 23, 2025


16,090 posted on 05/23/2025 9:40:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16089 | View Replies]

To: AdmSmith; BeauBo; FtrPilot; BroJoeK

It is disturbing to see this report explaining how determined Putin, Dugin, and other important Russian figures are to restore the old Soviet Union’s aggressive plans to keep pressing Ukraine and Europe. No true peace in any of their plans. Trump is wise to save his energy trying to persuade them to change.

Meanwhile, Lithuania, for one is not waiting for the hammer to fall. They have extensive plans to make any Soviet style aggression by Russia to be a very costly move as described in this short video:

https://www.youtube.com/watch?v=A57My6gssr4 [3.5 min.]

Lithuania has about a 60km border with Poland and there are plans to increase the number of good roads between the two countries. Unfortunately, Lithuania also has at least 600km of border with Russian controlled territory. This 60km border with Poland separates continental Russian territory (specifically Russian satellite, Belarus) with the Kaliningrad enclave which gives Russia a seaport on the Baltic Sea, and thus exit to the Atlantic Ocean. This gap is a narrow barrier between two Russian territories which Russia will want to attack or defend with vigor. Lithuania has no intention of letting Russia walk over any of it’s borders. There is around 200km of border with Kalingrad, and 400km of border with Belarus, and thus Russia itself. Lithuania plans heavy border defenses, and Poland, Latvia, and Estonia will no doubt take part in similar difensive moves. Nobody who has been under Soviet control ever wants to repeat the experience with a like-minded Russia as Putin and company now plan.


16,091 posted on 05/23/2025 9:45:15 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16086 | View Replies]

To: gleeaikin

16,092 posted on 05/23/2025 9:46:04 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16091 | View Replies]

To: PIF; BeauBo; LowIQ
Didn't I tell ya?

DIDN'T I TELL UA??

US Vice President J.D. Vance:


"The era of American global hegemony is over."

pic.twitter.com/9F6MUoc19B— Sprinter Observer (@SprinterObserve) May 23, 2025


16,093 posted on 05/23/2025 10:40:32 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16092 | View Replies]

To: AdmSmith

“Thank God, total mobilization will begin soon!”

If Russia does that, it will trigger significant reactions across the West.


16,094 posted on 05/23/2025 11:02:53 AM PDT by BeauBo
[ Post Reply | Private Reply | To 16079 | View Replies]

Meet the scumbags placed on the White House lawn this morning for the world to see — the worst of the worst criminal illegal immigrants sent back where they belong in President Trump's first 100 days. pic.twitter.com/CbQ3OjOQKZ— Rapid Response 47 (@RapidResponse47) April 28, 2025


16,095 posted on 05/23/2025 1:09:15 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16094 | View Replies]

To: JonPreston

16,096 posted on 05/23/2025 1:09:56 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16095 | View Replies]

To: JonPreston


16,097 posted on 05/23/2025 1:10:58 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16096 | View Replies]

To: JonPreston
<☮️ )
16,098 posted on 05/23/2025 1:11:27 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16097 | View Replies]

To: JonPreston
P>
16,099 posted on 05/23/2025 1:11:49 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16098 | View Replies]

To: JonPreston

16,100 posted on 05/23/2025 1:12:44 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16051 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,061-16,08016,081-16,10016,101-16,120 ... 19,281-19,284 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson