Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,821-15,84015,841-15,86015,861-15,880 ... 19,381-19,391 next last
To: BeauBo; PIF; FtrPilot; All

Putin’s peace talks negotiator claimed Russians have extra chromosome

https://www.yahoo.com/news/putin-peace-talks-negotiator-claimed-124232879.html


15,841 posted on 05/17/2025 3:12:19 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 15835 | View Replies]

To: BeauBo

The extra Russian chromosome guy claims Russia can fight on for the next 21 years. Perhaps that’s what the extra Russian chromosome does?

https://freerepublic.com/focus/f-news/4317457/posts

https://freerepublic.com/focus/f-chat/4317502/posts


15,842 posted on 05/17/2025 4:49:06 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15831 | View Replies]

To: gleeaikin

Now that Russia seems to be increasing its efforts in Lybia

If 47 succeeds in sending 1 million Palestinians to Libya, then the Russians would be able to recruit them directly for troops in Ukraine. They love death after all, and that would be a ready-made opportunity.

https://freerepublic.com/focus/news/4317465/posts?page=1


15,843 posted on 05/17/2025 4:53:36 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15833 | View Replies]

To: AdmSmith

Only 910 casualties - the lull before the storm? As Mordvichev becomes the Russian ground commander and formalizes the uses of meat waves as the main tactic to gain ground?


15,844 posted on 05/17/2025 5:03:57 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15839 | View Replies]

Ukraine Situation Report: Third F-16 Viper Lost
Unlike the two prior crashes, the Ukrainian F-16 pilot in this incident survived.
https://www.twz.com/news-features/ukraine-situation-report-third-f-16-viper-lost

Excerpts:
“According to preliminary data, the pilot destroyed three air targets and was working on the fourth, using an aircraft cannon,” the Ukrainian Air Force stated on Telegram. “However, an emergency situation arose on board. The pilot took the plane away from the settlement and successfully ejected.” - the Ukrainian Air Force

While we don’t yet know what caused the crash, firing a fighter’s gun against small and possibly slow-moving targets - such as cruise missiles and drones - is far more dangerous than many realize, a topic we have discussed frequently in the past. Flying into the target is a real risk, among other factors. This is especially true at night.

From an earlier story: “The speed and engagement dynamics involved can result in controlled flight into the ground below as well as ramming into the very object you are trying to shoot down. There is also the danger of the grenade-like cannon rounds impacting the ground below over a relatively wide area, potentially killing innocent people. Doing it at night is a whole other level of danger.”

For Ukraine, this is at least the third loss of a Viper.


15,845 posted on 05/17/2025 5:07:01 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15844 | View Replies]

🍈

Only 40 posts in two days??

WTH has happened on this Thread?

15,846 posted on 05/17/2025 5:21:01 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15845 | View Replies]

To: marcusmaximus; PIF
From the link:

Mr Medinsky also earned widespread ridicule after arguing that Russians were particularly heroic and able to survive hardship because they “have one extra chromosome”. While it is likely that he was trying to speak figuratively, the assertion, made in 2012, prompted scorn even within Russia, with critics pointing out that having an extra chromosome is associated less with genetic superiority than with conditions such as Down's syndrome.

It is not better with other trisomy disorders:

https://en.wikipedia.org/wiki/Trisomy

15,847 posted on 05/17/2025 5:21:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15841 | View Replies]

To: JonPreston
HOLY SMOKES: Trump takes a blow torch to the neocons and interventionists while speaking to the Saudis. This is a VICTORY speech over globalism.

"It's crucial for the wider world to know this great transformation has not come from Western interventionists, or flying people in beautiful planes giving you lectures on how to live and how to govern your own affairs."

"In the end, the so-called nation builders wrecked far more nations than they built and the interventionalists were intervening in complex societies that they did not even understand themselves."

"No, the gleaming marvels of Riyadh and Abu Dhabi were not created by the so-called 'nation builders,' neocons, or liberal non-profits like those who spent trillions and trillions of dollars failing to develop Baghdad, so many other cities."

"Instead, the birth of a modern Middle East has been brought by the people of the region themselves, the people that are right here, the people that have lived here all their lives, developing your own sovereign countries, pursuing your own unique visions and charting your own destinies in your own way."

"They told you how to do it, but they had no idea how to do it themselves. Peace, prosperity, and progress ultimately came not from a radical rejection of your heritage, but rather from embracing your national traditions and embracing that same heritage that you love so dearly."

"You achieved a modern miracle the Arabian way."

No wonder they respect him so much.

15,848 posted on 05/17/2025 5:22:00 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15846 | View Replies]

To: JonPreston
Russian Spokeswoman, Maria Zakharova regarding the "cocain" video of Macron, Starmer and Merz:

"In the video: the President of France, the Prime Minister of Britain, and the Chancellor of Germany.

Having pushed Zelensky into yet another hellish intrigue to sabotage a settlement and continue the bloodshed in Europe, like in the joke, the Frenchman, the Englishman, and the German got on a train and... took a hit.

Apparently, they did it so thoroughly that they forgot to hide their paraphernalia (a little baggie and a spoon) before the journalists arrived.

The fate of Europe is being decided by dependent and temporary figures—in every sense of the word.

Incredible footage. It's as if the Almighty Himself is pulling back the curtain on this foul gathering, so that 'those with eyes may see.'

In 2022, I asked a Western ambassador: 'How can you supply weapons to the unbalanced drug addict Zelensky? He’s been on cocaine for years!'

And I got the reply: 'For the EU, that’s normal — many Western leaders use.'"

***********

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Ukrainian Bombs Rip Through Strategic Russian Base, Producing up to 9,000 Drones/Month! ]

Today [ Apr 25, 8 pm ], there are a lot of interesting updates from the Russian Federation. Here, flying deep behind enemy lines, Ukrainian long-range drones delivered a devastating blow to the only Russian Shahed production facility. Long-range drones loaded with 250 kilogram bombs tore through the final assembly line, throwing all Russian strike plans into disarray.

The Ukrainian strike happened at Yelabuga, located over 1,200 km away from the frontline. The Ukrainians used 6 drones for the strike on the main Shahed assembly facility, of which 5 Ukrainian drones managed to reach and directly strike their target despite Russian air defenses being present.

The strike led to severe damage to the final assembly line of the drone production facility, creating a bottleneck and disrupting the entire production process within the factory. This assembly is the most technologically complex segment, without which the rest of the drone production process cannot be completed. Targeting this facility hampers Russia’s ability to produce new Shaheds, thereby severely impacting its ability to continue its daily drone strikes on Ukraine.

For the strike, Ukrainians used small A-22 light training planes repurposed as drones to strike critical Russian military and economic infrastructure far beyond the frontline. These drones have a maximum flight range of over 1,500 km, with integrated GPS inertial guidance to conduct precision strikes. Each of these drones has an integrated payload of 250 kg, able to collapse the facility’s roof, already damaging production machinery, which was then followed by the next drone striking the factory floor itself, finishing the job.

The destruction of the assembly line at the Alabuga facility throws a massive wrench into Russian plans, as the Russians are exerting considerable effort to scale up production and increase the number of Shahed drone strikes. Since the launch of this factory, which produced 300 Shahed drones daily before the Ukrainians hit it, Russia has steadily increased the number of Shahed strikes each month.

Following the completion of the Alabuga drone production complex, the Russians continued to increase their production output, launching a massively increased number of Shahed drone strikes in the past 6 months. This number could have risen to 9,000 by the end of April, prompting the Ukrainians to urgently develop a plan to strike the Russian Shahed production facility.

The strike on the Alabuga plant was additionally prompted by the recent Russian development of an analogue to Ukraine’s Palianytsia jet-propelled drone. The upgraded Shahed, called the Geranium-3, features a turbojet engine for increased speed, raising from 200 kph to 600. This enhancement makes it much harder for Ukrainian mobile air defense units to intercept them, primarily relying on truck-mounted machine guns and autocannons to take down the Shaheds.

Western sources report that the Alabuga factory was a key producer of these new Russian jet-powered Shahed drones. With the new drones being significantly more difficult to intercept for conventional Ukrainian mobile air defense units, Ukraine would have had to rely on more expensive and very limited missile defense systems to protect its cities.

Destroying Russian production capabilities before these drones could be produced and implemented on a larger scale was a strategic play to prevent the Russians from exploiting weak spots in Ukrainian air defense, while the laser air defense is still in the early stages. This also shows that Ukrainians know the locations of these critical Russian factories, and can continue to target them, if they struggle to intercept the new Shaheds.

While Ukrainians have many potential targets to hit, they must choose wisely, due to the amount of time needed to plan and set conditions for such complex aerial operations, making it impossible to strike every location simultaneously.

Overall, the Ukrainians conducted a precision strike on the largest and most important Russian drone production facility, over a 1,000 km away from the frontline, causing massive damage to its production capabilities and greatly diminishing the number of drones available for further Russian strikes. The effects of the Ukrainian strike will be evident, with the planned Russian increase of Shahed strikes not becoming a reality.

Lastly, the strike demonstrates Ukraine’s constant awareness of potential Russian threats, making educated decisions on which facilities to hit with the most urgency, to achieve the most significant effect.

https://www.youtube.com/watch?v=-Tr9_gR1_6w

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russians Lost Air Superiority. Biggest Swedish Military Aid Package Changes The Game! ]

Today [ Apr 28, 8 pm ], there is an interesting update concerning the defense of Ukrainian skies. Here, the Ukrainian air defense got one of the biggest boosts as reports emerged that a new powerful flying radar from Sweden had probably already arrived in Ukraine. This system will help the Ukrainian air defenses not only in their offensive operations but will also significantly support their ability to defend the Ukrainian rear from constant Russian missile and drone attacks.

Sweden has pledged to deliver two ASC-890 airborne warning and control system planes to Ukraine as part of its largest military aid package to date, valued at approximately 1.16 billion euros. Sweden’s decision marks a significant enhancement in Ukraine’s air defense capabilities.

These aircraft, equipped with advanced Erieye radar systems, are designed to provide long-range surveillance and target identification. While official confirmation is pending, there are reports that a calibration aircraft was flying over western Ukraine, which might indicate Ukrainians are making final preparations, recalibrating and fine-tuning ground-based radars for the arrival of the new Swedish planes.

The ASC-890, based on the Saab 340 airframe, is an airborne early warning and control aircraft. It features the Erieye radar, a fixed, active electronically scanned array mounted atop the fuselage. This radar system offers a detection range of up to 450 km and can track multiple targets simultaneously, including aircraft, missiles, and drones.

By operating at high altitudes of 6,000 meters, the ASC-890 can monitor vast areas, providing real-time data to command centers and enhancing situational awareness. Essentially, aircraft like the ASC-890 serve as flying radar stations and command centers, coordinating air and ground operations effectively, with its compact size and reliability making it ideal for rapid deployment.

In the context of Ukraine’s current defense infrastructure, the ASC-890 represents a substantial upgrade. Ukraine’s existing radar systems are primarily ground-based, and even though some of them have a range of around 350 to 400 km, their immobility limits their range and makes them vulnerable to terrain obstructions. The ASC 890’s airborne platform overcomes these limitations, offering a broader and more flexible surveillance capability. This enhancement is crucial for the early detection of incoming threats, more accurate tracking of them, and a better response time that would allow Ukrainian air defense to intercept air threats more successfully.

The integration of the ASC-890 is particularly significant in light of Ukraine’s acquisition of Western fighter jets, notably the F-16s. After the manufacturer, SAAB, made some updates to improve the interoperability between the 2 systems, the ASC-890 can now provide these aircraft with comprehensive situational awareness, guiding them to targets and alerting them to potential threats.

As a result, these awacs will significantly improve the engagement range of the F-16s, allowing them to use their modern air-to-air missiles at their maximum ranges, as well as providing a significant improvement to the limited radar detection range of the F-16.

This synergy enhances the operational effectiveness of fighter jets, enabling more precise and coordinated missions. Additionally, the ASC-890’s data can even support Soviet-era Ukrainian fighter jets, extending their operational capabilities despite technological disparities. Sharing real-time radar data and threat information with ground-based command centers, Ukrainians can then relay targeting and situational awareness updates to the pilots via secure radio or datalink.

This allows older aircraft, despite lacking modern onboard radars, to operate more effectively by flying with external guidance and warning support.

Contrastingly, Russia’s equivalent platform, the Beriev A-50, has faced significant challenges. Since early 2024, Ukraine has successfully targeted and destroyed at least two A-50 aircraft, utilizing systems like the Patriot missile defense. These losses have compelled Russia to operate its remaining A-50 fleet even further from the front lines, diminishing its surveillance effectiveness over Ukrainian territory. [ Now grounded ]

The reduced presence of A-50s near Ukraine hampers Russia’s ability to conduct continuous airborne surveillance and coordinate air operations effectively.

Overall, the arrival of Sweden’s ASC-890 aircraft is a strategic boon for Ukraine, especially amid uncertainties regarding continued American intelligence support. These aircraft not only bolster Ukraine’s air defense and surveillance capabilities but also ensure greater autonomy in operational planning and threat response.

As the war continues the ASC890 will fill in gaps as a critical asset in safeguarding Ukrainian airspace and enhancing the effectiveness of its aerial operations.

https://www.youtube.com/watch?v=uWyhob-p3wU

15,849 posted on 05/17/2025 5:22:30 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15848 | View Replies]

To: JonPreston
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )

15,850 posted on 05/17/2025 5:23:27 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15800 | View Replies]

To: JonPreston
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )

15,851 posted on 05/17/2025 5:24:39 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15850 | View Replies]

To: AdmSmith
Mr Medinsky also earned widespread ridicule after arguing that Russians were particularly heroic and able to survive hardship because they “have one extra chromosome”

Talk about chromosomes, have you Brits done anything about that Hapsburg chin?


15,852 posted on 05/17/2025 5:28:51 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15847 | View Replies]

To: AdmSmith

It is not better with other trisomy disorders:


Wonder which of these the Russians have? Or is it a completely new disorder? Feel free to speculate.

The most common types of human autosomal (non-sex chromosome) trisomy that survive to birth are:
Trisomy 21 (Down syndrome)
Trisomy 18 (Edwards syndrome)
Trisomy 13 (Patau syndrome)
Trisomy 9
Trisomy 8 (Warkany syndrome 2)

Trisomy of sex chromosomes can also occur and include:
XXX (Triple X syndrome)
XXY (Klinefelter syndrome)
XYY (Jacobs syndrome)

https://en.wikipedia.org/wiki/Trisomy


15,853 posted on 05/17/2025 6:22:38 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15847 | View Replies]

To: JonPreston; Sidebar Moderator; admin

Stop using my posts; you do not have my permission to repost them in your blatant efforts to destroy this thread.


15,854 posted on 05/17/2025 6:25:07 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15849 | View Replies]

To: PIF
24MAR2022
The Superiority of the Russian Nation
As with most other similar theories, it is based on an exaggerated idea of ​​the role and significance of the Russian nation, which is given the features of a unique and unrivaled subject of history. This thesis has two vectors: internal and external. The internal vector assumes the recognition of the unconditional priority of the nation over the individual. The external vector assumes the recognition of the unconditional superiority of the Russian nation over all other nations and peoples. In its most tragicomic form, this thesis was expressed in the words of one of the main court ideologists, Medinsky, about the presence of an additional chromosome in Russians.

Ukraine as the Holy Grail
Following Solzhenitsyn and other Eurasianists, the Kremlin attaches a special mythical significance to control over Ukraine. The thesis about the impossibility of the existence of the Russian Empire if Ukraine is not part of it, never rationally substantiated by anyone, is accepted as an absolute axiom and is fundamental in all of the Kremlin's geopolitical constructs. In its understanding, Ukraine is worth both the Mass and a “special operation” that can be carried out in the center of Europe as the last and decisive battle.
The right to war

The presence of a sacred goal is a self-sufficient justification for war as a means of achieving this goal. Nietzschean motives are mixed in with this, smacking of a fair amount of Dostoevskyism - am I a trembling creature or do I have the right? In the Kremlin's view, “I can” means both “I have the right” and “I must.”

Russia should repeat the path of Germany - it needs denazification - as the main nation in the world that professes Nazism in its most dangerous manifestations. Pastukhov did not dare to say this, but this is the only way out for Russia.
https://trim-c.livejournal.com/4566781.html

15,855 posted on 05/17/2025 6:58:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15853 | View Replies]

To: PIF

They aren’t your posts and this isn’t your thread. They’re reports you brought here that I in turn reposted without comment.


15,856 posted on 05/17/2025 7:05:00 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15854 | View Replies]

To: BeauBo
Rosstat reports threefold slowdown in Russian economy

According to the first official estimate, Russia's GDP grew by 1.4% year-on-year in the first quarter — three times less than the quarter before (4.5%) and almost four times less than the same period last year (5.4%).
Preliminary data for April indicate that the cooling continues, says Alexander Isakov, an economist for Russia at Bloomberg Economics. The PMI business activity index in industry is below 50 points, which means a decline in production, and in addition, freight transportation on the Russian Railways network is rapidly declining - by 9.7% year-on-year. This means that, with a high probability, by the end of the second quarter, the economy will slide into a technical recession (a decline for two quarters in a row), writes Isakov.

Paradoxically, a possible peace deal with Ukraine, for which the US promises the Kremlin an easing of sanctions, could result in a new “shock” for the economy, says Alexandra Prokopenko, a research fellow at the Carnegie Russia Eurasia Center. Trillions in defense spending and handouts to military contractors accounted for 40% of economic growth last year, according to estimates by the Bank of Finland's Institute for Emerging Economies.

“If the Kremlin wants to avoid an economic collapse, it needs to keep spending at current levels long after the war is over,” says Janis Kluge, an expert at the German Institute for International Security Studies. “If military spending is cut, it will lead to job losses and general disillusionment in many regions,” he explains. “A peace deal will be a new shock to the economy, but a manageable shock,” says Prokopenko. “Putin will have to replenish his arsenals, which means that military spending will remain elevated for a couple of years after the war.”

https://www.moscowtimes.ru/2025/05/16/rosstat-konstatiroval-zamedlenie-rossiiskoi-ekonomiki-vtroe-a163610

15,857 posted on 05/17/2025 7:06:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15806 | View Replies]

To: PIF
If 47 succeeds in sending 1 million Palestinians to Libya, then the Russians would be able to recruit them directly for troops in Ukraine. They love death after all

Pure Trump hate. Again.

15,858 posted on 05/17/2025 7:10:33 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15843 | View Replies]

To: JonPreston; Sidebar Moderator; admin; JR

They aren’t your posts ... they’re reports you brought here


Yes they are my posts, and you used them without asking or attribution. A post is any material uploaded to FR, even if they came from elsewhere. A post does not have to be original content written by a FR poster himself.

You are doing all of this just to destroy & to make unreadable this thread and, in the process, undermining FR itself, by driving away prospective donors and existing donors. Actions like yours are one of the main reasons FR finds it difficult to get timely donations.


15,859 posted on 05/17/2025 7:21:28 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15856 | View Replies]

To: PIF

I contribute to a thread that’s slowing down considerably, related to the unwinding of the war - thank you President Trump - and reckless comments by you and others. I post more than half the posts to this Thread, and without them, this would be a ghost town. That’s hardly damaging things.


15,860 posted on 05/17/2025 7:29:18 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15859 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,821-15,84015,841-15,86015,861-15,880 ... 19,381-19,391 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson