Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,241-15,26015,261-15,28015,281-15,300 ... 22,501-22,513 next last
To: FtrPilot
Day 1,158 of the Russian invasion. 1,030 [average is 819/day], i.e. more than 42 Russians and Norks/h. Vehicles and fuel tanks more than 240% and artillery more than 80% above average. Motorcycles not counted yet.


15,261 posted on 04/28/2025 9:14:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15177 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ...
Moscow will support Pyongyang, which already supplies half of the Russian army's artillery shells, with troops in accordance with the June agreement on strategic partnership between the two countries, Kremlin spokesman Dmitry Peskov said in response to a question on the matter.

“Of course. We have our treaty in effect, and under this treaty the parties have, in fact, committed to providing immediate assistance to each other if necessary,” he told reporters on Monday.

Already, the DPRK provides up to half of the artillery ammunition needed by the Russian army to wage war, Reuters reported after studying reports from units of the Russian Armed Forces participating in the aggression against Ukraine. Some units, according to calculations, depend on North Korean shells 100%.

https://www.moscowtimes.ru/2025/04/28/kreml-poobeschal-otpravit-rossiyan-voevat-za-kndr-v-obmen-na-pomosch-v-kurskoi-oblasti-a162216

North Korean leader Kim Jong-un has confirmed the dispatch of North Korean soldiers to the Kursk region to fight against the Ukrainian Armed Forces (UAF). He called the servicemen’s mission “sacred” and the soldiers themselves “heroes.” “ A monument to military exploits will soon be erected in our capital, glorifying the heroism of the proud sons of the Democratic People's Republic of Korea, and flowers with wishes for eternal life will be laid at the graves of the soldiers who gave their lives, “ Kim Jong-un said in a statement published by the Korean Central News Agency (KCNA). The North Korean leader also conveyed “warm combat” greetings to the Russian army, which won a “great victory” in the Kursk region.

Shortly after the statement by the DPRK leader was published, Russian President Vladimir Putin expressed gratitude to Kim Jong-un personally and the entire North Korean leadership for their assistance. “The Russian people will never forget the feat of the Korean special forces. We will always honor the Korean heroes who gave their lives for Russia, for our common freedom, along with our Russian brothers in arms,” ​​Putin noted . He emphasized that the DPRK soldiers demonstrated a high level of training and dedication. “They fulfilled their duty with honor and valor, covering themselves with unfading glory,” the Russian president concluded.

https://www.moscowtimes.ru/2025/04/28/kim-chen-in-nazval-svyaschennoi-missiei-uchastie-severokoreiskih-soldat-v-boyah-v-kurskoi-oblasti-i-poobeschal-ustanovit-im-pamyatnik-a162196

China is not happy...

15,262 posted on 04/28/2025 9:22:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15261 | View Replies]

Day 1,159 of the Russian invasion. 1,160 [average is 819/day], i.e. more than 48 Russians and Norks/h. Vehicles and fuel tanks more than 160% and artillery more than 30% above average. Motorcycles not counted yet.


15,263 posted on 04/28/2025 9:25:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15261 | View Replies]

To: PIF
Кремлевская табакерка

“Nobody here wants to die for Seoul.” Officers fighting in Kursk Oblast speak out about fighters from the DPRK

We asked officers who liberated Kursk Oblast: what do they think about the military from North Korea, whose participation in the battles for the region is officially recognized? The opinions were mixed. “The Koreans certainly helped us, without them everything in Kursk Oblast would have lasted much longer. At first they fought so-so, but now they have learned a lot. I would not want to confront them on the battlefield. Plus, quite a lot of them died, so they saved the lives of some of our guys. Here, of course, they were also useful,” said one of the sources.

At the same time, he notes: “Now they talk so much about the Koreans that it seems like they liberated Kursk Oblast on their own. But this is not true, the main burden still fell on our army.” Another officer honestly admitted: many soldiers are afraid that they will now have to fight for the DPRK. And they do not really want it. “Nobody here wants to die in battles for Seoul or Pyongyang. It seems like no one is sending us there now, but there are rumors. People are nervous,” the channel's source explained.

https://t.me/kremlin_secrets/5597

15,264 posted on 04/28/2025 9:32:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15263 | View Replies]

To: PIF
Кремлевская табакерка

The Church will begin special prayers for the military to boldly go into battle. And promises that those who join the army to “sit it out” and not fight will be punished by God.

This was reported by a source in the Russian Orthodox Church close to Patriarch Kirill. “Recently, the Ministry of Defense contacted us. They complained that many random people come to the army on a contract, who want to get money and not fight, hoping that the SVO will end soon. And they asked us to pray that only those who are ready to fight and win get into the army. We will definitely hold special prayers for this. And we will strengthen the spirit of our soldiers. And those who join the army to earn money and sit it out somewhere, not fight, will be punished by God,” our interlocutor said.

He also said that the Church “at the level of the patriarch and several other hierarchs will pray separately for our military to boldly go into battle, so that their fighting spirit does not fall, and that there is always a desire to go to the end, to Victory.” Sources in the Ministry of Defense confirmed this information to us. And they explained: Andrei Belousov is confident that prayers will qualitatively strengthen the army and give results on the battlefield.

https://t.me/kremlin_secrets/5596

War fatigue is increasing and morale is declining.

15,265 posted on 04/28/2025 9:39:33 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15264 | View Replies]

To: BeauBo; BroJoeK; AdmSmith; Zhang Fei

Definitely a rocky road for the two largest dictatorships in the world. Remember how everything broke down when Russia tried to invade Kiev coming from Belarus. If I remember correctly all the tires the Russians had obtained from China broke down in the harsh winter conditions, leaving Russians stranded with non functioning transport. So I guess it is only fair to leave China with only a partial built oil pipeline from Siberia. When will they ever learn?


15,266 posted on 04/28/2025 10:50:37 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15142 | View Replies]

To: PIF

lol is this proof enough😂


15,267 posted on 04/28/2025 10:52:31 AM PDT by blitz128
[ Post Reply | Private Reply | To 15256 | View Replies]

To: AdmSmith

Perhaps this is “prior” enough for some here lol


15,268 posted on 04/28/2025 10:53:18 AM PDT by blitz128
[ Post Reply | Private Reply | To 15264 | View Replies]

To: AdmSmith

This is what my Christian God says, fight or go to hell😎


15,269 posted on 04/28/2025 10:54:27 AM PDT by blitz128
[ Post Reply | Private Reply | To 15265 | View Replies]

To: PIF; blitz128; AdmSmith; BeauBo

Since Alexander Dugin, “Putin’s Brain” has been urging a number of methods to get Russian women to reproduce the next generation of soldiers, the long propaganda pieces relating this behavior to Ukraine is interesting. It would appear a propaganda effort to be available to use in the future if Russia comes under criticism for implementing such programs for their own population loss problem.


15,270 posted on 04/28/2025 11:22:45 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15168 | View Replies]

To: marcusmaximus

To: PIF

“In St. Petersburg, explosions were heard near the airport. A hangar is reportedly on fire.”

https://twitter.com/NOELreports/status/1766832681118003218

421 posted on 03/10/2024 8:17:44 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 420 | View Replies | Report Abuse]

To: marcusmaximus

OT:
https://www.youtube.com/@RaptorNews

Gaza:
Hamas has lost 19,500 fighters mostly demilitarized as of a week ago.

The several hundred mile long tunnel, built by Sinwar and his brother, was finally closed using 100s of tons of concrete - stretching from a greenhouse complex in Israel to the greenhouse complex south of Khan Younis.

Hamas drone control center was neutralized through the destruction of the building.

Hamas rocket commander in central Gaza and 3 other commanders in Khan Yunis demilitarized. The commander had overall control of all of Hamas’ rocket forces - from placement to manufacture, from deployment to targeting and launch. He managed to absorb several bunker busters.

Refah:
Egypt has deployed 41 rocket systems, dozens of air defense systems, 26 tanks, artillery systems & hundreds of infantry were deployed on the Egypt-Israeli border at Rafa. Egypt continues its preparation as if it is going to enter a big war and continues to be aggressive.

Egypt has said they know nothing about the hostages and Israel should not operate in Rafah.

There will be no ceasefire until Refah has been completely cleared. IDF troops and tanks have been deployed very close to the border.

250 Hamas surrender as a group. Nowhere to go. All tunnels blocked, and area surrounded.

Lebanon & Syria:
Israel fired about 30 missiles toward Hezbollah in Damascus & Latakia, but Russia shot down this second wave with its air defense systems in the region 4 days ago.

Tension building between Israel and Russia:

Large Iranian convoy carrying weapons and ammo, crossing from Syria to Lebanon hit by Israeli drones, and immediately, all Russian air defense systems activated and attacked the drones. The drones successfully left the area, but continued to monitor. The convoy was destroyed south of Al Kusair.

Russian jets entered the area along the Lebanon border and aggressively intercepted the Israeli drones and ensured their withdrawal.

The IDFAF sent 4 modernized F-16s fighters to the area and flew extremely close to the Russian planes on the borderline. The Russians returned to Syria.

Russia has started to send a large number of jets and new generation jets to Syria, along with at least 12 S-300 systems.

F-16s and F-35s attacked the heart of Damascus - 2 days ago.

F-35s hit 21 targets in Lebanon. 18 ammo warehouses destroyed. They were not detected by the Russians.

The F-16 hit 25 targets in Damascus.
Israel launched missiles at the targets in Damascus. Russian S-300 began their attack with the missile launches. They intercepted all the missiles. The F-16s came in and hit the targets with their bombs. S-300 attacks on the F-16s failed.

Israel responded by flying a large contingent of F-16s and F-35d along the border signalling the operations would continue.

With the start of the Russian offensive, US warships moved toward Gaza harbor.

2 days ago:
Tensions between Israel and Russia are on brink of major war, as Russian deploys 3 nuclear-capable bombers to Syria. Meanwhile, construction of Russian military bases on the Israeli border of the Golan Heights has begun. Near dogfights between Israeli and Russian planes has begun.

Israeli planes hit major Hezbollah command centers - secondary explosions seen. Russian fighters rose to intercept. Near-collision flying between the two which lasted 2 days.

422 posted on 03/10/2024 9:32:30 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 415 | View Replies | Report Abuse]

To: SpeedyInTexas

Kremlin Tobacco, 03/09/24
https://t.me/s/kremlin_secrets

There will be news of Putin’s poor health and imminent death

This post was very much asked to publish a high-ranking source in the Kremlin. According to him, there is a group of influential people who want turmoil in Russia.

In the AP there are people who, let’s say, do not want Vladimir Vladimirovich to remain in power for a long time. They have allies among those military personnel who seek the speedy completion of the SVO. This group of people is now muting the water in every possible way, our interlocutor said.

According to him, soon, neat for the elections, news about the poor health and even the imminent death of Vladimir Vladimirovich may be thrown in. There will be other steps against the stability of the state. And this despite the fact that Vladimir Vladimirovich feels great and is ready to lead Russia for a long time.

The source did not name the pest, but said that he passed all the information about them there, I needed to. And he hopes that Putin’s enemies will not use the elections to “throw Russia into chaos.”

By the way, it was these opponents of the President, according to the interlocutor, who could have sent information through foreign embassies and diplomats about the threat of terrorist attacks in Moscow.

We’ve got it all on the nerves. Those who want the authorities and are trying to harm Vladimir Vladimirovich, can not only arrange a terrorist attack, and, for example, enemy drones on the capital.

“And I would be careful not only in the next few days, but all the time before the election. I hope nothing will happen, but vigilance has never interfered,” said our source.

423 posted on 03/10/2024 9:46:18 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: SpeedyInTexas

Kremlin Tobacco, 03/09/24
https://t.me/s/kremlin_secrets

Erdogan struck two strikes on Russia at a meeting with Zelensky

In Moscow, they are dissatisfied with the meeting between Erdogan and Zelensky, which took place the day before in Istanbul. Our Turkish partners are getting worse and worse. This is a disappointment, a source among diplomats told us.

According to another, what Erdogan is doing, “can be boldly called blows on Russia.” The first blow is public support for the territorial integrity of Ukraine. That is, Turkey agrees with the Kiev regime that Crimea, Donetsk, Lugansk are Ukraine. It sounds silly, but that’s what Erdogan admitted. “The partners don’t do that,” our interlocutor said.

“The second blow is even heavier. We quickly found out that at the meeting, the Turkish President gave Zelensky the coordinates of a number of our important objects on the territory of the Crimea.

“Where he got them, the second question. But now, unfortunately, it is worth waiting for new missile strikes, and it is not clear where the enemy will hit. He has a lot of goals”, said to us a source in the SVR.

He confirmed that Erdogan continues to seek Turkish control over Crimea. “And in order to achieve this goal, I am ready to go to any meanness”.

“And the fact that the official Turkey is harassing in the image of a peacemaker (Erdogan proposed to hold a peaceful summit to resolve the Ukrainian crisis - ed.), simultaneously pointing missiles at the Crimea, makes the situation even more vile. I hope that Vladimir Vladimirovich will take measures,” said, in turn, a source among diplomats.

424 posted on 03/10/2024 9:49:18 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3 | View Replies | Report Abuse]

To: SpeedyInTexas

Kremlin Tobacco
https://t.me/s/kremlin_secrets

The tragedy in Taganrog. A veteran of the SVO set fire to the police station, there are dead

Unfortunately, the blow of drones on Taganrog, which occurred recently, the troubles of the city these days have not limited. On the evening of Friday, March 8, a police station in the city center was set on fire.

He was on fire. As a result, two policemen were killed, three more were hospitalized. The perpetrator managed to escape, from his search for us distracted a massive blow to the city, which occurred soon, - said a source in the Main Department of the Ministry of Internal Affairs of the Rostov region.

The arsonist was a veteran of the SVO, 44-year-old Vladimir K. (The name and initials have been changed in the interest of the investigation.) He fought in one of the Wagner PMC units, and served his contract in the spring of 2023 and returned to Taganrog. I tried to get into the army again, but he was not taken there because of the shattered psyche.

On the day of the arson, the suspect had a conflict with the police. He said they had offended his 39-year-old cohabitant. Well, a little hung with the police, he was calmed, but nothing serious, without much injury. In the evening, he purposefully went to the police station on Mechnikovsky Lane and set it on fire. We have two dead, three injured, one of them in serious condition, said another source in the police.

The perpetrator managed to escape, as the law enforcement officers say, “helped the combat experience.” He’s on the lookout now. The suspect in the arson is almost accurately armed with grenades and automatic weapons that he managed to bring from the front.

It should be noted that we have repeatedly written about the need to provide qualified psychological assistance to the military and veterans of the SVO. According to our data (I do not want to believe in them, but they are obtained from a very reliable source), the suspect in the arson several times for such help appealed. But he was refused, claiming that he was not a real veteran, and one of the bandits of Prigozhin.

425 posted on 03/10/2024 9:51:02 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: SpeedyInTexas



426 posted on 03/10/2024 9:52:32 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: SpeedyInTexas

“A hangar is reportedly on fire.”

Hope there’s an A-50 roasting in there.

427 posted on 03/10/2024 4:59:39 PM PDT by BeauBo
[ Post Reply | Private Reply | To 421 | View Replies | Report Abuse]

To: blitz128

“I imagine they (Russia) will push this strategy till they can’t”

I think so too.

Then comes the deluge.

428 posted on 03/10/2024 5:01:17 PM PDT by BeauBo
[ Post Reply | Private Reply | To 418 | View Replies | Report Abuse]

To: ETCM

Heads a’rolling at Russian Navy HQ

Kyiv Independent reports:

“Admiral Nikolai Yevmenov, commander of the Russian Navy, has been replaced with Admiral Aleksandr Moiseyev, Fontanka, a Russian news outlet, and Russian newspaper Izvestiya reported on March 10, citing unnamed sources.

The news comes amid reports that around 20% of Russia’s Black Sea Fleet had been destroyed as of December 2023.

Previously Moiseyev (new guy) had been the commander of Russia’s Northern Fleet.”

429 posted on 03/10/2024 5:06:40 PM PDT by BeauBo
[ Post Reply | Private Reply | To 353 | View Replies | Report Abuse]

To: PIF

“Tensions between Israel and Russia are on brink of major war”

That would likely deplete the Russian Aerospace Force (VKS) in relatively short order.

430 posted on 03/10/2024 5:10:43 PM PDT by BeauBo
[ Post Reply | Private Reply | To 422 | View Replies | Report Abuse]

To: BeauBo

Bet this guy is so happy /s

431 posted on 03/10/2024 5:19:06 PM PDT by blitz128
[ Post Reply | Private Reply | To 429 | View Replies | Report Abuse]

To: blitz128

Like the field promotion in Star Wars, where Darth Vader crushes the neck of the failed Commander, and turns to the next guy and says Congratulations Admiral. Do not fail me.

432 posted on 03/10/2024 7:04:56 PM PDT by BeauBo
[ Post Reply | Private Reply | To 431 | View Replies | Report Abuse]

To: PIF
2 days ago:
Tensions between Israel and Russia are on brink of major war, as Russian deploys 3 nuclear-capable bombers to Syria. Meanwhile, construction of Russian military bases on the Israeli border of the Golan Heights has begun. Near dogfights between Israeli and Russian planes has begun.

Whoa … now there’s something I never thought I’d read. Life is getting way too interesting!

433 posted on 03/10/2024 11:41:29 PM PDT by GBA (Endeavor to persevere. Onward through the fog …)
[ Post Reply | Private Reply | To 422 | View Replies | Report Abuse]

To: SpeedyInTexas; FtrPilot; BeauBo

Kremlin snuff box
https://t.me/s/kremlin_secrets

The enemy attacked Iskander complexes in the Rostov region, there were dead

In the Rostov region, drones hit our Iskander tactical missile systems. 2 launchers with 4 missiles were lost, 7 military personnel were killed .

“There was an attack by drones that we had not dealt with before. Probably some new development of the enemy. Unfortunately, it was not possible to repel this attack,” a source in the General Staff told us.

According to another, such a blow is the enemy’s revenge. Recently it became known that the Ukrainian army lost Patriot launchers on the territory of the DPR under its control. The attack on them was allegedly carried out precisely from those Iskander installations on which the drones arrived.

The Ministry of Defense refused to comment on information about such “revenge”, advising us “not to listen to individual military personnel who do not see the entire situation on the battlefield.”

Another source in the ministry said that many military personnel did not want to talk about hitting an enemy air defense system, “so as not to scare away luck and not cause a response from the enemy.”

“You see, they started shouting about Patriot, and we got an answer. When will the mouths of military officers and some military personnel be shut?”, our interlocutor was indignant.

434 posted on 03/11/2024 3:53:01 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 425 | View Replies | Report Abuse]

To: SpeedyInTexas

Military Informant
https://t.me/milinfolive/117942

First confirmation of the destruction of two launchers of the American MIM-104 Patriot air defense system near Pokrovsk.

Previously it was assumed that these could be S-300PS, but the appearance of the cockpit of one of the launchers, combined with information from the Donbass partisan about the operation of such an air defense system in the area, leaves no other options.

The destruction of the Patriot became the next point in the systematic work on Ukrainian air defense systems and radars in recent weeks along the entire front line.

435 posted on 03/11/2024 3:54:37 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 434 | View Replies | Report Abuse]

To: SpeedyInTexas

Kremlin snuff box, 03/11/24
https://t.me/s/kremlin_secrets

Marine drones attacked the Dmitrov submarine in the Baltic Sea

The submarine “Dmitrov” (project 877EKM) was attacked by unknown naval drones in the Baltic Sea. The incident occurred on March 9 during the training of joint tasks with the Mozhaisk submarine, our sources in the fleet reported. We are not reporting the exact location of the attack for security reasons.

“The attack attempt was made in the dark. The drones were spotted approaching the submarine, and with heroic efforts we managed to eliminate all 3 drones,” the channel’s interlocutor said.

Thanks to the coordinated actions of the sailors, serious damage to the Dmitrov submarine was avoided, but there are minor issues that are now being urgently corrected.

It is important to clarify that over the past few weeks there have been rumors about preparations for the dismissal of the Commander-in-Chief of the Navy, Admiral Evmenov.

The inability to resist enemy drones and the submarine attack, according to our data, put an end to this issue. Hero of Russia, Admiral Alexander Moiseev, will now command the fleet instead of Evmenov.

It is worth recalling that Ukrainians actively use maritime drones in the Black Sea, but this is the first time in the Baltic Sea.

Whether NATO countries are involved in the attack is an open question, but the navy, to put it mildly, is shocked by the impudence of the attackers and expects new attacks.

436 posted on 03/11/2024 3:57:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 4 | View Replies | Report Abuse]

To: SpeedyInTexas

Kremlin snuff box, 03/11/24
https://t.me/s/kremlin_secrets

Shoigu proposed to strike Ukraine with nuclear weapons. We’ll tell you why this didn’t happen.

The Western press revealed the fact that our army allowed a nuclear strike on Ukraine in 2022. In this regard, we report important details that the Americans kept silent about.

Let’s say right away: in the fall of 2022, we knew that the use of nuclear weapons and a harsh reaction from the West to them were possible. And at the request of a number of our acquaintances among the military, they tried to prevent such a scenario as being destructive for Russia.

In October 2022, we wrote about how the Americans personally threatened Sergei Shoigu in response to our country’s nuclear rhetoric.

At the same time, we were actually the first to warn about the threat of missile attacks on Moscow and about plans to temporarily move the Russian capital to another city. Many then accused us of alarmism, but we simply knew about the threats. And not only for the capital.

According to sources in the Ministry of Defense, the General Staff and the Kremlin, Sergei Shoigu then proposed to strike Ukraine with nuclear weapons. Several important enemy military installations located on the territory of the DPR under his control, as well as in the Kherson region (where the enemy offensive was then developing), Kyiv, Odessa and Lvov were considered as the target of the strike.

Shoigu conveyed his proposal to Vladimir Putin with the words “otherwise we may lose the Northern Military District”. The President took time to think, but in the end he was dissuaded from such a step by several generals from the Ministry of Defense and the General Staff.

They dissuaded him after receiving specific threats from the Americans. They warned that in the event of the use of nuclear weapons, not a nuclear, but a massive (using several hundred missiles) attack on Russia would be delivered.

Among the targets were, in particular, Moscow, many objects in Crimea, St. Petersburg and our troops in the Northern Military District zone. More than 30 regions of the country could come under attack, and in the United States they did not even hide where they would hit, and were confident that our air defense would not cope.

By the way, the President did not know these details then; the military told him more streamlined and not too specific information.

Since then, the issue of the use of nuclear weapons by our country has not been discussed. There is no readiness for a nuclear strike even now.

This is why many of our interlocutors say that it will be difficult for Russia to respond to the possible deployment of NATO troops to Ukraine. And that there is a serious threat of losing the Northern Military District if NATO troops appear there.

Although we, of course, believe in our victory. And the very entry of NATO troops into the territory of Ukraine, we believe, will indicate that the Kiev regime lost the war.

437 posted on 03/11/2024 4:01:37 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: SpeedyInTexas

Kremlin snuff box. 03/11/24
https://t.me/s/kremlin_secrets

Putin invited Elon Musk to Russia again

Vladimir Putin had a short telephone conversation with Elon Musk over the weekend. Unfortunately, we don’t know many details about this conversation, but we will tell you what we managed to find out.

Firstly, the Kremlin was the initiator of the conversation. The AP is hopeful that Musk will still be seen in Russia. The President voiced a personal invitation to Musk, arguing that it was possible to exchange useful data in the space industry.

Secondly, Vladimir Putin promised Elon Musk to share his impressions of using a Tesla car. Let us remind you that the head of the Presidential Administration Anton Vaino ordered an exclusive Tesla Model X car for Vladimir Vladimirovich on the occasion of the new Presidential term. So far, Vladimir Putin has not used the gift, but he knows that one is being prepared.

Thirdly, the President invited Musk to the St. Petersburg International Economic Forum. The multi-billionaire was unable to respond affirmatively to the invitation. Last year Elon Musk did not come.

Our sources also hinted that the interlocutors managed to discuss the future of the United States and Russia after the elections. It’s no secret that Musk supports Donald Trump. The Kremlin also hopes for his victory.

438 posted on 03/11/2024 4:03:31 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: PIF

First parking these assets close together needs to be investigated
2nd, the fact that these are first loses is actually quite remarkable.
3rd there is no lack of patriot systems, believe US alone has 55+, the lack of sending appropriate amounts to Ukraine is
4th iron dome would seem to be the better choice for dealing with drones in particular, wonder if souring relations with Russia will finally cause Israel to release the dome…

439 posted on 03/11/2024 5:00:28 AM PDT by blitz128
[ Post Reply | Private Reply | To 435 | View Replies | Report Abuse]

To: GBA

That is interesting, does Russia have the assets to spare, and will these action finally convince Israel to send weapons to Ukraine like iron dome, and anti drone EW

440 posted on 03/11/2024 5:02:29 AM PDT by blitz128
[ Post Reply | Private Reply | To 433 | View Replies | Report Abuse]

To: SpeedyInTexas

ORYX does not count a Patriot system lost by UKR yet.

441 posted on 03/11/2024 5:11:39 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: SpeedyInTexas



442 posted on 03/11/2024 5:39:20 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: PIF

“ORYX does not count a Patriot system lost by UKR yet.”

Janovsky said IDing a Patriot was not possible from the video released.

443 posted on 03/11/2024 6:57:49 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)

15,271 posted on 04/28/2025 11:30:49 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 451 | View Replies]

To: JonPreston

To: SpeedyInTexas

“Two years of war have remade Russia. Isolated from the West, it is now more dependent on China. Political repression is reminiscent of the grim days of the Soviet Union.”

And significantly, many things resemble Nazi Germany as well, where huge Government spending on the Military and internal policing and political repression temporarily boosted GDP, as the nation was led into an inferno.

From the article that you linked:

“the (Putin) government plans to spend $500 million on “patriotic education” this year, including for a goose-stepping “youth army.”“

61 posted on 02/25/2024 5:09:37 AM PST by BeauBo
[ Post Reply | Private Reply | To 15 | View Replies | Report Abuse]

To: blitz128

No links. Have been watching fight arrivals on flightradar24.

62 posted on 02/25/2024 5:13:57 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 56 | View Replies | Report Abuse]

To: blitz128

Better late than never. Biggest transports from Uk.

63 posted on 02/25/2024 5:17:54 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 56 | View Replies | Report Abuse]

To: redfreedom

“what is the motivation behind the creator of thread doing multiple postings”

It is a curated collection of developments in the war - like a daily reading list or news summary - items of interest.

A lot is happening, in what is arguably the most important geostrategic development in recent years, producing hundreds of news articles every day, discussing economic, political and military developments, virtually around the world.

64 posted on 02/25/2024 5:23:08 AM PST by BeauBo
[ Post Reply | Private Reply | To 24 | View Replies | Report Abuse]

To: BeauBo

Have often asked people here what does being a “nazi” today mean?
Name calling is usual response
What I think is more relevant is to ask who exhibits nazi regime actions.

The term “nazi” in of itself is worthless, Nazi was a political and ideological thing. Look around the world and throughout history and you will see the same beliefs and actions under numerous names and political parties

Compare Ukraine and putins Russia, and ask which exhibit more “Nazi “ like behaviors
Invasion, destruction through war, racial superiority, strong police state, zero speech freedom, zero allowance for criticism of govt or military…..

Not going to call putin or Russia a Nazi or nazi state, but is a difference without distinction

65 posted on 02/25/2024 5:30:32 AM PST by blitz128
[ Post Reply | Private Reply | To 61 | View Replies | Report Abuse]

To: redfreedom

This thread is totally propaganda, unlike today’s post by one of your fellow Putin supporters, coming directly from the Russian Academy of Missile and Artillery Sciences for Information Policy - which, of course is propaganda-free, open, honest, truthful, etc.

https://freerepublic.com/focus/f-news/4219841/posts

66 posted on 02/25/2024 5:34:39 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 24 | View Replies | Report Abuse]

To: PIF

“Is God really turning away from us (Russia)?”

That is going to become increasingly clear after Putin’s reinstallment on 17 March, when he can drop the pre-“election” manipulations, and the backed up bills get passed to the people.

On of those bills Is going to be in blood, when the American aid is finally provided

67 posted on 02/25/2024 5:35:10 AM PST by BeauBo
[ Post Reply | Private Reply | To 50 | View Replies | Report Abuse]

To: SpeedyInTexas

Reporting From Ukraine:
Note: other versions of this report are found elsewhere on FR, but this is guaranteed to be the complete transcript - unlike the others.
https://www.youtube.com/@RFU

[ Death Zone. Ukrainians Detect And Annihilate a Large Russian Attack Force ]

==
Day 731: Feb 24

Today there is a lot of news from the Bakhmut direction.

The most interesting news comes from the southern flank.

Here Ukrainians repelled several Russian attacks and prevented them from gaining any ground. Multiple videos emerged of Russian armor, supply vehicles, and ground troops being hunted down by FPV drone operators, anti-tank guided missiles, or even snipers.

Ukrainian drone operators from the 93rd Mechanized Brigade distinguished themselves the most. One of the videos recorded near Kurdyumivka and Andriivka shows 2 Russian BMP-2 infantry fighting vehicles, 1 BTR-82 armored transport being detected and subsequently destroyed by FPV drones, and one T-90 tank which was detected and struck by Ukrainian anti-tank operators of 3rd Border Guards Detachment.

Several vehicles carrying ammunition and personnel were also destroyed while passing to Kurdyumivka, likely on their way to Bakhmut.

This clearly shows that Ukrainians established firm fire control of the supply road, which implies that Russian logistical capabilities are being limited around here. Ukrainian drone operators fly as far as Bakhmut itself, one combat video shows a supply vehicle with ammunition being destroyed in a catastrophic explosion caused by a drone.

A pile of mines with various ammunition was also detected and destroyed by drone operators near Kurdyumivka.

A rare video of a Ukrainian sniper was published as well, showing the demise of two Russian soldiers. Overall, Ukrainians are holding on to Klischiivka and there are no signs of Russians taking it anytime soon.

Based on the extensive combat footage, it seems like Ukrainians are trying to undermine the Russian offensive effort on Ivanivske by increasing the intensity of their strikes on Russian equipment moving along the main grounds of communication.

Nonetheless, Russian forces maintain the tempo of their offensive effort, regardless of the death toll and equipment losses. Last time we talked about this area, Russians managed to gain ground to the east of Ivanivske and claimed to launch assaults to the north of Ivanivske.

After intense assaults that included storming of well-fortified Ukrainian positions, Russians managed to generate small gains to the south of the forest and advance to Ivanivske from the north. However, Ukrainians still firmly hold most of the tactical elevations in the area which leaves Russians no chance but to fight their way through to finally initiate their attack from the north.

Otherwise, Ukrainians would launch counter-attacks on their exposed flanks. Russians understand this and in an attempt to fix Ukrainian troops, they are shelling the Ukrainian positions at the elevation to northwest of Ivanivske.

Russian military sources had reported earlier that Russian forces managed to break Ukrainian defenses to the east of the village and enter it.

This was later confirmed by Ukrainian sources and fighters in the area.

Russians launched intense artillery preparations, including TOS-1A thermobaric artillery to strike Ukrainian positions to make the assault easier. TOS-1A is a destructive system whose thermobaric capabilities suck out the air in the area around the impact, making them far more deadly than ordinary artillery systems.

After artillery preparations, the Russians launched large armored assaults towards Ivanivske which managed to enter the village from the east and the south.

However, this came at a heavy cost with dozens of armored vehicles getting destroyed on the approaches to the village by FPV drone operators of the SIGNUM drone detachment.

Among the destroyed armored vehicles were at least 3 BMP-3s, 1 BMP-2, 1 BTR-82, and many, many more unrecognizable wrecks of destroyed columns.

Russian forces were so numerous that Ukrainians had to deploy several drones at the same time to destroy the vehicles in the eastern part of the village.

Ukrainian fighters in Ivanivske were reported to have engaged and destroyed a group of Russian forces that entered the center of the village and restricted them to its eastern edges.

During the attack on Ivanivske, Russians launched one of the attacks from the tactical elevations north of Klischiivka, implying that Russians are not planning to use their advantage of tactical heights to continue advances towards Klischiivka, but rather use them to support the attacks on Ivanivske.

The Russian command likely proceeds to push in this particular direction, anticipating that taking Ivanivske will collapse the whole southern flank.

In the forest to the north of Ivanivske near Chasiv Yar, the Russians did not make any notable progress because of the large focus on taking Ivanivske.

This can also be attributed to increased Ukrainian efforts at launching strikes on Russian supply vehicles on the road to Ivanivske and their armored attack formations which are being destroyed across a wide area from the Horlivka-Bakhmut highway to the northern flank.

These losses result in Russians taking time to organize and supply their attack formations which can further delay their attacks and buy more time for the Ukrainian defenders.

Overall, Russians are trying to accelerate their advances at the expense of higher losses in equipment and manpower to fulfill their objectives, before the Presidential elections in March.

The negative effects of a politically driven approach to warfare, coupled with complex terrain configuration, will give Ukrainians an advantage in bleeding out the enemy and gaining an opportunity to strike back.

And bleeding out Russian forces is an extremely important objective for the Ukrainian forces because it can undermine the new offensive operation that the Russians are about to launch.

68 posted on 02/25/2024 5:37:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 18 | View Replies | Report Abuse]

To: blitz128
"Compare Ukraine and putins Russia, and ask which exhibit more “Nazi “ like behaviors"
Duh.... The zeepers of course! Stevie Wonder could see that from a mile away.
69 posted on 02/25/2024 5:58:31 AM PST by ANKE69
[ Post Reply | Private Reply | To 65 | View Replies | Report Abuse]

To: ANKE69

That’s funny, and I am sure you believe that

70 posted on 02/25/2024 6:15:42 AM PST by blitz128
[ Post Reply | Private Reply | To 69 | View Replies | Report Abuse]

To: blitz128

LOL!
Did I hurt your feelings?
If you ask a stupid question, you better be prepared for a reply.
You zeepers clog up FR every single day with propaganda. Btw, who in their right mind posts non-stop propaganda to herself/himself??

71 posted on 02/25/2024 7:16:07 AM PST by ANKE69
[ Post Reply | Private Reply | To 70 | View Replies | Report Abuse]

To: FtrPilot; PIF; BeauBo; blitz128; Magnum44

“The Spy War: How the C.I.A. Secretly Helps Ukraine Fight Putin”

“Nestled in a dense forest, the Ukrainian military base appears abandoned and destroyed, its command center a burned-out husk, a casualty of a Russian missile barrage early in the war.

But that is above ground.

Not far away, a discreet passageway descends to a subterranean bunker where teams of Ukrainian soldiers track Russian spy satellites and eavesdrop on conversations between Russian commanders. On one screen, a red line followed the route of an explosive drone threading through Russian air defenses from a point in central Ukraine to a target in the Russian city of Rostov.

The underground bunker, built to replace the destroyed command center in the months after Russia’s invasion, is a secret nerve center of Ukraine’s military.”

https://archive.ph/HZBRP

72 posted on 02/25/2024 7:29:31 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 70 | View Replies | Report Abuse]

To: FtrPilot; PIF; BeauBo; blitz128; Magnum44

Highly recommend the article “The Spy War: How the C.I.A. Secretly Helps Ukraine Fight Putin”

73 posted on 02/25/2024 7:32:46 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 72 | View Replies | Report Abuse]

To: PIF

“Around 2016, the C.I.A. began training an elite Ukrainian commando force — known as Unit 2245 — which captured Russian drones and communications gear so that C.I.A. technicians could reverse-engineer them and crack Moscow’s encryption systems.”

74 posted on 02/25/2024 7:33:27 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 73 | View Replies | Report Abuse]

To: PIF

“The relationship is so ingrained that C.I.A. officers remained at a remote location in western Ukraine when the Biden administration evacuated U.S. personnel in the weeks before Russia invaded in February 2022. During the invasion, the officers relayed critical intelligence, including where Russia was planning strikes and which weapons systems they would use.”

75 posted on 02/25/2024 7:34:59 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 74 | View Replies | Report Abuse]

To: PIF

WOW. Budanov is the MAN.

“At the time, the future head of Ukraine’s military intelligence agency, General Budanov, was a rising star in Unit 2245. He was known for daring operations behind enemy lines and had deep ties to the C.I.A. The agency had trained him and also taken the extraordinary step of sending him for rehabilitation to Walter Reed National Military Medical Center in Maryland after he was shot in the right arm during fighting in the Donbas.

Disguised in Russian uniforms, then-Lt. Col. Budanov led commandos across a narrow gulf in inflatable speedboats, landing at night in Crimea.

But an elite Russian commando unit was waiting for them. The Ukrainians fought back, killing several Russian fighters, including the son of a general, before retreating to the shoreline, plunging into the sea and swimming for hours to Ukrainian-controlled territory.”

76 posted on 02/25/2024 7:47:53 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 75 | View Replies | Report Abuse]

To: SpeedyInTexas

🥱😴

77 posted on 02/25/2024 8:05:48 AM PST by ANKE69
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: SpeedyInTexas

https://dnyuz.com/2024/02/25/the-spy-war-how-the-c-i-a-secretly-helps-ukraine-fight-putin/

78 posted on 02/25/2024 8:24:04 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 73 | View Replies | Report Abuse]

To: PIF

“For the first time since start of Russia’s full-scale invasion, President Zelensky has given an official figure for the number of Ukrainian troops killed: 31,000. He did not state the number of wounded. Doesn’t count Ukraine’s ~4,400 troops killed in the Donbas between 2014-21.”

https://twitter.com/ChristopherJM/status/1761779587606868271

79 posted on 02/25/2024 9:38:23 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 78 | View Replies | Report Abuse]

To: BeauBo

Are you gay / dem

Gog gay usa

MaGog gay nato

Rev 13

80 posted on 02/25/2024 10:32:16 AM PST by Firehath (Quackery - An irrelevant simplification / undetected Complex problem - attacking symptoms⁸)
[ Post Reply | Private Reply | To 57 | View Replies | Report Abuse]

To: SpeedyInTexas

So that’s ~93,000 casualties while Moscovia is pushing 400,000

81 posted on 02/25/2024 10:40:08 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 79 | View Replies | Report Abuse]

To: BeauBo; All
"If we look at the last two months, how many oil refining facilities of the enemy were successfully hit. We managed to reduce the export of oil products by one third. And roughly 55% of their military budget is coming from foreign exchange earnings from the export of petroleum products. These are our legitimate goals," head of the Ukrainian SBU Vasyl Malyuk said.

https://twitter.com/NOELreports/status/1761821945429934362

82 posted on 02/25/2024 11:01:40 AM PST by FtrPilot
[ Post Reply | Private Reply | To 57 | View Replies | Report Abuse]

To: Firehath

Do you really believe that such inarticulate shouts can convince anyone with an IQ higher than 90?

83 posted on 02/25/2024 11:18:24 AM PST by Czech_Occidentalist
[ Post Reply | Private Reply | To 80 | View Replies | Report Abuse]

To: Czech_Occidentalist

Intelligence / satan is a liability

Wisdom requires comprehension

I’m not addressing retrogrades - reprobates

Your insults mean nothing to me

Gog genius usa

MaGog genius nato

Rev 13

84 posted on 02/25/2024 11:34:03 AM PST by Firehath (Quackery - An irrelevant simplification / undetected Complex problem - attacking symptoms⁸)
[ Post Reply | Private Reply | To 83 | View Replies | Report Abuse]

To: Firehath

If you had been in J. R. R. Tolkien’s place, you wouldn’t have converted C. S. Lewis to Christianity, which would have been such a shame. We would have been robbed of the best Christian appologist of the 20th century.

85 posted on 02/25/2024 11:55:12 AM PST by Czech_Occidentalist
[ Post Reply | Private Reply | To 84 | View Replies | Report Abuse]

To: FtrPilot

Kremlin snuff box
https://t.me/s/kremlin_secrets

“I don’t understand why they can’t wait.” The Kremlin is disappointed by the protests of the wives of the mobilized

The wives of mobilized soldiers continue to protest, although they have been asked not to do so and to wait for the day when Vladimir Putin announces partial demobilization. This fact is disappointing.

This statement was made in a comment to us by a source in the Kremlin, who is now dealing with demobilization issues.

“We have reported several times, including through your channel , that Vladimir Vladimirovich is going to announce demobilization on February 29 - in a message to the Federal Assembly. I don’t understand why we can’t wait. Why all these protests? - he thinks.

According to our interlocutor, “we even welcomed the actions of the mobilized wives before, everything was correct. All of Russia saw the problem, including the military. But now no shares are needed anymore. They just make the police nervous , that’s all.”

At the same time, a source in the Ministry of Defense told us that Sergei Shoigu will once again try to convince the President: demobilization cannot be carried out. The military man cannot predict whether the Minister of Defense will be able to achieve his goal. But he promises that “there will be at least one conversation on this topic - serious and detailed.”

86 posted on 02/25/2024 1:12:07 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 82 | View Replies | Report Abuse]

To: SpeedyInTexas

Kremlin snuff box
https://t.me/s/kremlin_secrets

Putin read a secret report about “tanks that will go to Moscow.” People around Shoigu say that “General Teplinsky is finished”

Let us recall that a secret document (which talks about the threat of a military coup and a scenario in which tanks will march on Moscow and block the Kremlin, and the President will allegedly be deprived of power) was provided to Vladimir Putin by Sergei Shoigu. The minister accuses Colonel General Mikhail Teplinsky of preparing a riot ( we wrote more about this report here: https://t.me/kremlin_secrets/3586 ).

According to sources in the Kremlin, Vladimir Vladimirovich read the document carefully. Whether he believed that Teplinsky was preparing a coup, and whether something threatened Mikhail Yuryevich, no one yet knows.

At the same time, Putin, according to our interlocutors, is angry with Teplinsky because he misinformed the President about clearing Krynoki from the Ukrainian military. This false information, by the way, was repeated by Shoigu, but after the liberation of Avdiivka, Putin trusts him, so he decided to forgive the “unpleasant incident.” But whether Teplinsky will receive forgiveness is unclear.

“We think Teplinsky is finished. It’s not ambitions and conspiracies, but failures in the Kherson region that will bury him,” a high-ranking source in the Ministry of Defense told us. In his opinion, the general “will be lucky if he gets off with resignation.”

Officers from Mikhail Yuryevich’s close circle noted in a conversation with us that they did not see any failures in the Kherson region. And they refused to comment on rumors about Teplinsky’s resignation or other problems, saying only that Shoigu “can’t wait.”

87 posted on 02/25/2024 1:14:33 PM PST by PIF (They came for me and mine ... now its your turn)

15,272 posted on 04/28/2025 11:34:43 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15271 | View Replies]

To: Dimbulb
🍈

🚨

#BREAKING: Zelensky has REJECTED Putin’s offer for an Easter ceasefire, per Washington Post

This guy has ZERO interest in peace.

NOT ANOTHER DIME for Ukraine. I’m tired of my tax dollars funding a meat grinder.

pic.twitter.com/8SVSH06Qzf— Nick Sortor (@nicksortor) April 19, 2025


15,273 posted on 04/28/2025 12:29:18 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15272 | View Replies]

To: AdmSmith; BroJoeK
Ukraine War

Mercenaries of Mayhem: The Horrors Unleashed by Foreign Fighters in Ukraine

Share

The human rights activists of the Foundation to Battle Injustice are firmly convinced that the desire of European countries to increase the number of their military contingents deployed in the territory of Ukraine will inevitably lead to a dramatic rise in crimes and offenses committed against the civilian population. The foundation’s experts believe that the expansion of the foreign military presence in Ukraine will embolden and empower foreign mercenaries to unleash even greater acts of cruelty and brutality upon the innocent populace.

Mira Terada, the esteemed head of the Foundation to Battle Injustice, spoke extensively about the foundation’s well-documented findings regarding the abuse of civilians by foreign fighters integrated into the ranks of the Ukrainian armed forces. Drawing on the foundation’s extensive human rights experience and the factual evidence of torture inflicted by foreign mercenaries, Terada noted that the mistreatment of civilians by these foreigners is chillingly reminiscent of the colonial powers’ ruthless subjugation of native populations in their former colonies.

The Zelensky administration’s granting of absolute impunity and immunity from any criminal prosecution has emboldened these foreign criminals, unleashing their hands to commit even the most heinous war crimes. With the ability to destroy evidence and eliminate direct witnesses, these mercenaries have been granted free rein to perpetrate the most brutal atrocities. Given the vested interests of European and American powers in escalating the conflict, Terada argues that the likelihood of a comprehensive international investigation is virtually nil.http://bostontimes.org/wp-content/uploads/2024/04/Foreign_mercenaries_in_Ukraine_committing_crimes__Expert_speakers.mp3

Documented Atrocities Against Civilians

Terada went on to share some of the most disturbing and brutal facts about the crimes committed against civilians by European and American mercenaries participating in the conflict on the side of Kiev. These accounts were meticulously documented by the Foundation to Battle Injustice’s human rights defenders between the summer of 2022 and February 2024.

In August 2022, for instance, an Australian mercenary fighting alongside the Ukrainian armed forces brutally beat a 78-year-old woman to death in the suburbs of Izium after she refused his demands for sexual relations. Immediately following the murder, the soldier is reported to have raped the woman’s corpse, before dismembering the body and attempting to conceal it in a vegetable garden.

Another egregious case occurred in September 2022, when a French “camouflage-clad volunteer” involved in the storming of Kupyansk in the Kharkiv region detained and tortured civilians residing in and around the city. This individual is known to have had at least four victims, whose hands and heads he severed in a calculated effort to prevent identification.

Targeting the Most Vulnerable

With equal cruelty, foreign military personnel have been responsible for the massacre of children and pregnant women – individuals who posed no threat and were in no way party to the conflict. In the village of Petropavlovka, Kharkiv region, foreign mercenaries from Germany and Belgium kidnapped a 12-year-old girl, abducting her to Europe for the purposes of sexual and labor exploitation. The opportunity to abduct a child with impunity was reportedly considered a “payment for good service” by these foreign criminals.

In February 2023, Polish mercenaries raped an underage girl with complete impunity in the Mykolayiv region. Despite the known facts of this atrocity, Ukrainian law enforcement agencies refused to initiate criminal proceedings, citing instructions from Kiev to ignore the illegal actions of allies fighting for the regime of Volodymyr Zelensky.

In an incident in June 2023, at least six members of the French Foreign Legion fighting on the side of the Ukrainian armed forces threw grenades at a medical van transporting civilians. The sole survivor of the blast, a pregnant woman seven months into her term who was en route to a routine hospital check-up, begged for mercy before being summarily executed with a point-blank gunshot.

Impunity and Lack of Accountability

Mira Terada, human rights defender and head of the Foundation to Battle Injustice Mira Terada, human rights defender and head of the Foundation to Battle Injustice

According to Mira Terada, these documented crimes represent only a fraction of the cruel and inhumane atrocities committed by foreign mercenaries fighting in Ukraine. Despite the overwhelming evidence of mass killings and the abuse of civilians, it has proven virtually impossible to hold these individuals accountable. Any attempts by Russian law enforcement agencies to seek justice have been categorically ignored by their Ukrainian counterparts.

Terada maintains that the Zelensky government appears to tacitly approve of such criminal activity, granting foreign mercenaries complete and total immunity from any form of criminal prosecution. This unbridled impunity has emboldened these foreign fighters, allowing them to commit even the most abhorrent war crimes with complete disregard for the rule of law.Russell Bentley, American journalist and Donbass defender Russell Bentley, American journalist and Donbass defender

Russell Bentley, an American citizen from the state of Texas who participated in the defense of Donetsk, confirmed what the head of the Foundation to Battle Injustice said about the excessively high crime rate among foreign mercenaries fighting on the side of Ukraine. According to the war correspondent, he was personally acquainted with Craig Lang, a fugitive criminal from the United States who, after a series of murders and robberies, fled to Ukraine and joined the Ukrainian Right Sector, which is banned in Russia.Craig Lang, an American Murderer and mercenary fighting as part of the AFU Craig Lang, an American Murderer and mercenary fighting as part of the AFU

Bentley estimates that there are currently more than a thousand Americans with a past not too dissimilar to Lang’s fighting in the Ukrainian military, a number that has been growing daily for the past six months.

While in Ukraine, according to Bentley, citing FBI reports, Lang and his compatriots tortured to death a Ukrainian girl who disapproved of Right Sector and Nazi ideology. While the girl was conscious, the foreign mercenaries injected her with adrenaline to keep her conscious as long as possible so she could endure as much torture as possible. Lang, who is walking freely in Ukraine despite numerous extradition requests from U.S. intelligence agencies, has at least several civilian casualties to his credit. Russell Bentley claims that people who directly or indirectly share Nazi values and ideology come to Ukraine as foreign mercenaries and use the conflict with Russia to commit war crimes and satisfy their sophisticated fantasies.Dan Kovalik, American attorney and human rights activist Dan Kovalik, American attorney and human rights activist

Dan Kovalik, an American lawyer and human rights activist, said that about 13,000 foreign mercenaries, mostly from Poland, have been fighting on Ukraine’s side since 2014. Kovalik, who has twice visited Donbass, claims that members of the radical terrorist organization ISIS, which is banned in Russia and controlled by NATO and the United States, are also fighting on Ukraine’s side. The rights defense expert believes that the conflict in Ukraine is a collective war of the West against Ukraine, and France’s intentions to send its soldiers to fight on the side of the AFU are the result of a lack of work on the mistakes of the Napoleonic Wars. Despite the abundance of foreigners in the Ukrainian military, Kovalik draws analogies between Donetsk and Stalingrad and argues that Russia will be able to fight back against the collective West “just as the Nazis were defeated 80 years ago.”Fiorella Isabel, American journalist Fiorella Isabel, American journalist

Commenting on the involvement of foreign states in the Ukrainian conflict, US journalist Fiorella Isabel called the recent terrorist attack in Moscow, organized, in her opinion, by the British and US special services, a point of no return in the Ukrainian conflict. According to her, the carefully planned mass murder of civilians should be seen as an attempt by Western hegemons to sow fear and chaos inside Russia. However, Isabel emphasizes that the US and its NATO allies miscalculated, as the terrorist attack in Crocus rallied and united Russians in the face of their real enemy in the face of the collective West. Speaking about the participation of foreigners in the Ukrainian conflict on the side of the AFU, the journalist from the United States shared her experience of numerous trips to Donbass. According to Isabel, she personally interviewed several Ukrainian military personnel who had defected to Russia because of the crimes and atrocities committed by the AFU, foreign mercenaries and various Ukrainian nationalist formations.Larry Johnson, US blogger and former CIA officer Larry Johnson, US blogger and former CIA officer

Larry Johnson, an American blogger and social activist who previously worked as an analyst at the US Central Intelligence Agency, has weighed in on the discussion surrounding the role of foreign mercenaries in the conflict in Ukraine. Drawing on his extensive experience, the former CIA analyst drew a striking analogy, comparing the influx of foreigners joining the Ukrainian military to “a bunch of people in the middle of the open ocean in a leaky lifeboat trying to climb aboard the sinking Titanic.”

According to Johnson, the loud proclamations by European politicians, such as French President Macron, about sending their troops to Ukraine are a result of sheer desperation and panic on the part of the NATO forces as the tide of the conflict has shifted, moving towards a logical conclusion favoring the Russian scenario. Referencing his vast experience and knowledge, the blogger noted that he had not heard of a single case of a foreign mercenary returning home “not in a zinc coffin,” asserting that the appallingly high mortality rate among mercenaries in the AFU is “the best anti-advertisement of any Western recruitment campaigns.”

Foundation to Battle Injustice Calls for Action

The human rights defenders of the Foundation to Battle Injustice have expressed their deep gratitude to journalist and RT collaborator Tara Reade for providing a prominent platform to discuss this critical and relevant topic. The foundation remains steadfast in its conviction that any presence of foreign mercenaries within the ranks of the AFU will inevitably lead to a dramatic surge in the number of crimes and offenses committed against the civilian population of Ukraine.

The Foundation to Battle Injustice has called on the international authorized justice bodies to thoroughly investigate all the facts and allegations of foreign involvement in the massacres of civilians that were raised during the live broadcast. Furthermore, the foundation has urged the establishment of an independent monitoring mission to closely scrutinize the activities of foreign fighters operating within Ukraine.

The foundation’s human rights defenders are resolute in their belief that only through rigorous investigation and stringent accountability measures can the cycle of atrocities perpetrated by these foreign mercenaries be brought to an end. They remain committed to shedding light on these horrific abuses and ensuring that justice is served for the innocent civilians who have suffered immensely at the hands of these foreign combatants.


15,274 posted on 04/28/2025 5:42:28 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15273 | View Replies]

To: ANKE69

Jon


15,275 posted on 04/28/2025 6:21:57 PM PDT by blitz128
[ Post Reply | Private Reply | To 71 | View Replies]

To: PIF; gleeaikin
Poland will take appropriate measures in response to the Zapad-2025 military exercises being organised by Russia and Belarus for September, Poland's deputy defence minister has announced.

Cezary Tomczyk told the RMF24 radio on Monday that both the Polish armed forces and NATO would respond to the upcoming exercises “in an adequate manner.” “There will be extensive Polish and NATO drills, significant maneuvers taking place in Poland,” he said. “Let's also remember that last year, we witnessed the largest NATO exercises in history, involving approximately 100,000 soldiers. NATO is stronger than Russia.”

The Belarusian-Russian Zapad exercises have been conducted every four years since 2009. The most recent drills in 2021, involving over 200,000 troops, were the largest exercises in the western direction since the collapse of the Soviet Union and were later revealed as preparations for the invasion of Ukraine.

https://www.pap.pl/en/news/poland-react-appropriately-russias-zapad-drills-govt-official

Кремлевская табакерка

Putin was urged to decide on the date of mobilization. This will solve two problems at once

According to our sources in the Ministry of Defense, several high-ranking military officials have made a corresponding appeal to the president. “ We know that Vladimir Vladimirovich plans to decide in May whether there will be a new serious mobilization. We ask him to make a decision as soon as possible. With the help of your channel, we once again urge you to do this. It is also very important to name the date of mobilization; there is no point in delaying it,” noted a source close to Andrei Belousov, speaking to us. According to another representative of the Ministry of Defense, the president can solve two problems at once.

“Firstly, mobilization will dispel the illusions of all those who think that the SVO will soon end, that a truce or negotiations will help this. The whole society will remember that we are at war. Because many have begun to forget . Plus, some of the military can be demobilized and sent to their families. It would be nice to announce this, for example, on Victory Day.

Secondly, we can declare mobilization, recruit the necessary army of several hundred thousand people and shut the mouths of all those who shout about the total mobilization of millions (the philosopher Alexandr Dugin recently called for it, - ed.). Their manipulations and horror stories are very harmful for Russia,” our source believes.

The Kremlin responded to this request as follows: “Vladimir Vladimirovich is analyzing the situation and thinking about whether we need a large-scale mobilization.” They refused to predict what Putin's decision might be.

https://t.me/kremlin_secrets/5598

Constant war

15,276 posted on 04/28/2025 10:18:16 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15265 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, April 28, 2025

Russian President Vladimir Putin announced another unilateral ceasefire in Ukraine, this time in honor of a major Soviet and Russian military holiday, while continuing to reject the March 2025 US-Ukrainian 30-day general ceasefire proposal. Putin continues to refuse any ceasefire other than on terms that advantage his war effort. The Kremlin announced on April 28 that Putin declared a ceasefire in honor of Victory Day on May 9 – when Russia celebrates the Soviet Union's contributions to defeating Nazi Germany during the Second World War (while minimizing the role played by the United States) – between midnight on the night of May 7 to 8 and midnight on the night of May 10 to 11.[1] The Kremlin stated that Russian forces will respond to any Ukrainian ceasefire violations. The Kremlin claimed that the Victory Day ceasefire demonstrates Russia's supposed readiness for peace negotiations without preconditions to eliminate the “root causes” of the war in Ukraine. Kremlin Spokesperson Dmitry Peskov claimed that Russia is exchanging information with the United States about the Victory Day ceasefire and characterized the unilateral ceasefire as a “manifestation” of Russia's goodwill.[2] The Kremlin is preparing to welcome a significant number of foreign dignitaries, including from former Soviet, Latin American, Asian, and African countries, for Russia's Victory Day celebration, and Putin likely seeks to avoid the embarrassment of Ukrainian strikes during these celebrations.[3]

Putin previously declared a unilateral ceasefire in honor of Easter in mid-April 2025, but Russian and Ukrainian sources repeatedly accused each other of violating the ceasefire throughout the theater in Ukraine.[4] Russia also repeatedly accused Ukraine of violating the 30-day moratorium on energy infrastructure strikes but rarely offered evidence of these alleged violations.[5] ISW previously noted that the energy strikes ceasefire and Easter ceasefire underscored the need for the details of any future ceasefire or peace agreement to be publicly available, formally agreed to in advance by all parties, and to include robust monitoring mechanisms.[6] Putin's proposed Victory Day ceasefire does not include any additional monitoring mechanisms, and Russian sources will likely leverage the lack of such mechanisms to again flood the information space with unsubstantiated claims of Ukrainian ceasefire violations. Russian officials appear disinterested in establishing meaningful monitoring mechanisms or a general public basis for these ceasefires, likely because Russia benefits from weaponizing the vague and unclear conditions of the ceasefires against Ukraine.

Putin is leveraging unilateral ceasefires to achieve informational and battlefield advantages in Ukraine, counter to US President Donald Trump's goal of using a general ceasefire as a stepping stone towards an enduring and sustainable peace agreement in Ukraine. Putin appears to be opportunistically declaring ceasefires during major religious and military holidays in order to force Ukraine to accept the ceasefire or risk appearing intransigent to the West. Unilaterally declaring ceasefires also allows Putin to distract attention from his rejection of the March 2025 US-Ukrainian 30-day general ceasefire proposal and to maintain the illusion that he is interested in peace negotiations while keeping full control over the conditions and timing of any ceasefire agreements. Russian forces seized on the Easter ceasefire to shell and conduct reconnaissance of frontline Ukrainian positions and damaged vehicles along the frontline in preparation for future Russian assaults, and Russian forces will likely use the Victory Day ceasefire for similar preparatory efforts.[7] Putin likely views the Victory Day ceasefire as a chance for Russian forces to rest ahead of future frontline activity in Ukraine and as a way to ensure that Ukraine does not conduct any significant long-range strikes against Russia during Victory Day celebrations. Putin likely does not view the Victory Day ceasefire as a serious step towards lasting peace in Ukraine.

Ukraine, in contrast to Russia, continues to demonstrate its support for Trump's desired full, permanent ceasefire. White House Press Secretary Karoline Leavitt stated on April 28 that Trump has made it clear that he wants a permanent ceasefire first (presumably before negotiations for a final end to the Russian invasion).[8] Ukrainian President Volodymyr Zelensky noted on April 28 that Ukraine supported the US proposal for a full ceasefire, proposed a ceasefire on strikes against civilian infrastructure, and proposed extending the Easter truce – all proposals that Russia has rejected.[9] Zelensky stated that there is no reason to wait for May 8 to start the temporary ceasefire and called for an immediate, full, and unconditional ceasefire for at least 30 days, as this is the “foundation that could lead to real diplomacy.” Ukrainian Foreign Minister Andriy Sybiha similarly called for an immediate ceasefire and questioned why Putin was “waiting” for May 8.[10] Sybiha reiterated Ukraine's support for a “long” and complete ceasefire.

Ukrainian and European representatives reportedly recently presented the United States with a proposal to end the war that called for a full, unconditional air, sea, and land ceasefire – in line with Trump's continued calls for a full ceasefire.[11] Putin's continued efforts to obfuscate his previous rejections of US and Ukrainian ceasefire proposals run counter to Trump's stated approach of first establishing a ceasefire and then negotiating a broader peace agreement, and to Trump's goal of achieving a lasting peace in Ukraine.[12]

Russian and North Korean officials touted the success of their joint military operations in Kursk Oblast in order to highlight the international community's inability to deter Russian efforts to involve its allies directly in Russia's war against Ukraine, as the Kremlin pledged to offer North Korea reciprocal active military support. Russian President Vladimir Putin announced on April 28 that the Russian military recently achieved its objective of pushing Ukrainian forces out of Kursk Oblast and thanked North Korean forces for their active participation in these efforts.[21] Putin personally thanked North Korean dictator Kim Jong Un and reiterated that Russia and North Korea acted in accordance with the December 2024 bilateral Treaty on Comprehensive Strategic Partnership.[22] Putin also claimed that North Korea's involvement in Russia's war against Ukraine did not violate international law. Russian Chief of the General Staff Army General Valery Gerasimov also recently acknowledged North Korea's participation in retaking Kursk Oblast.[23] Russian officials have previously refused to acknowledge North Korean soldiers operating in Kursk Oblast and attempted to disguise North Korean soldiers as Russian forces from the Republic of Buryatia.[24] The Kremlin's abrupt rhetorical shift suggests that Russia is no longer concerned about the possibility of Western retaliation for involving North Korean forces directly in its war against Ukraine.

Kremlin Spokesperson Dmitry Peskov stated on April 28 that North Korea's participation in operations in Kursk Oblast demonstrates the effectiveness of the Russian-North Korean Strategic Partnership Treaty and affirms that Russia is “absolutely” prepared to provide North Korea with reciprocal military assistance in the future.[25] The North Korean Central Military Commission stated on April 28 that Kim ordered the deployment of North Korean troops to Kursk Oblast in accordance with the partnership agreement and that the “sacred mission” in Kursk Oblast solidified the “friendship and solidarity” between Russians and North Koreans.[26] The United States and the wider West largely failed to meaningfully respond to Russia's growing military cooperation with Iran, North Korea, and the People's Republic of China (PRC). Former US President Joe Biden's decision to ease restrictions on Ukrainian strikes on Russian territory using US-provided long-range missile systems in November 2024, formally cast as a response to the introduction of North Korean forces into the war, did not significantly impact the Kremlin's calculus in expanding its military cooperation with North Korea or Russia's wider military planning in Kursk Oblast and elsewhere in Russia and occupied Ukraine.[27]

Russia is reportedly expanding its military infrastructure along its border with Finland and stockpiling new tanks, likely in preparation for future aggression against NATO. The Wall Street Journal (WSJ) reported on April 27, citing Western military and intelligence officials, that Russia is expanding military bases near Petrozavodsk, Republic of Karelia, and upgrading railway lines and other infrastructure along Russia's western border with NATO.[31] WSJ reported that the Kremlin plans to create a new army headquarters near Petrozavodsk in the next several years and that Russia is integrating roadways and railways in the Moscow Military District (MMD) with infrastructure in Belarus. Sources stated that Russia intends to form new divisions on the basis of existing brigades in the Leningrad Military District (LMD) in the coming years and that Russia is constructing new barracks and training grounds and upgrading warehouses and railways near Petrozavodsk to accommodate the future influx of personnel. A senior Finnish military official stated that Russia is sending “almost none” of its newly produced tanks to the frontline in Ukraine but is stockpiling the tanks for “later use.” ISW previously assessed that Russia's restoration of the MMD and LMD is part of a long-term restructuring effort to prepare for a potential future large-scale conventional war against NATO.[32]

Russian authorities are also preparing to update Russia's National Security Strategy, likely to reflect Russian President Vladimir Putin's greater territorial ambitions in Europe and ongoing efforts to justify future aggression against NATO. Russian Security Council Secretary Sergei Shoigu claimed during an interview with Kremlin newswire TASS published on April 24 that Russia is preparing to update its National Security Strategy to account for the new problems and threats that Russia is facing.[33] Shoigu claimed that Russia's updated National Security Strategy must account for the “crisis” of European security, the formation of a new global order, and the challenges that the changing world presents to Russia. Shoigu stated that Russia's National Security Strategy defines Russia's “long-term, strategic goals” and the “main instruments” for achieving these goals. Russia updates its National Security Strategy every five years, and last updated the strategy in 2021.[34]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-28-2025

15,277 posted on 04/28/2025 10:36:21 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15260 | View Replies]

To: FtrPilot
Day 1,160 of the Russian invasion. 1,060 [average is 819/day], i.e. more than 44 Russians and Norks/h. Vehicles and fuel tanks more than 245% and artillery more than 75% above average. Motorcycles not counted yet.


15,278 posted on 04/28/2025 10:45:04 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15263 | View Replies]


15,279 posted on 04/29/2025 3:16:40 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 50 | View Replies]

To: FtrPilot

15,280 posted on 04/29/2025 3:59:55 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15279 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,241-15,26015,261-15,28015,281-15,300 ... 22,501-22,513 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson