Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,481-14,50014,501-14,52014,521-14,540 ... 22,401 next last
To: FtrPilot
Ukrainian flag


14,501 posted on 04/05/2025 4:51:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTYou have to wait aCAT)
[ Post Reply | Private Reply | To 14497 | View Replies]

To: All

14,502 posted on 04/05/2025 4:51:30 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14500 | View Replies]

To: AdmSmith
🐝🇺🇦 "Ukrainian fiber-optic drones with a range of 20 km are now operating at the front," — Syrskyi

👀 Previously, their range was limited to 5-10 km, but after the Brave1 tests, in which 15 manufacturers tested drones, it increased.

https://x.com/Maks_NAFO_FELLA/status/1908474945228697976

At 20 km, these drones, when equipped with thermal cameras, will be effective at artillery counter battery.

14,503 posted on 04/05/2025 4:56:07 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14501 | View Replies]

To: PIF
🇺🇸 ✈️ 🇺🇦 Russians write…

https://x.com/Maks_NAFO_FELLA/status/1908467774080294938

#NeverPootin

14,504 posted on 04/05/2025 4:59:41 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14503 | View Replies]

To: FtrPilot
IGOR STRELKOV:

Overall, we can state that we have already failed the spring-summer campaign — which is still to come — not lost, but failed! We still have to lose it (it is possible that the loss will not be very noticeable, or even completely unnoticeable for the average person, but not for the specialists in the enemy camp, unfortunately...).

Once again, we have done nothing to start winning the war (and it is already April, and even if the necessary measures begin tomorrow, the first positive effect from them will not be felt before August-September (and even that is not a fact)).

For us, another (even a “draw”, or even with some minor tactical successes (like the liberation of Ugledar, etc.)) “indecisive” military campaign is already a defeat , since this is “another step” not to victory, but strictly the opposite in that “war of attrition”, the conditions of which we frivolously considered advantageous for ourselves (and, in fact, they were simply imposed on us from the outside).

In addition, it is not at all excluded that the enemy will be able to more or less successfully inflict a series of painful blows on us (I am traditionally most worried about the Crimean direction, but not only). - Then the negative effect of another protracted and bloody campaign will be even worse than is currently expected. (Although, of course, I cannot rule out and I WANT to HOPE THAT THE ENEMY WILL AGAIN NOT SUCCESS WITH HIS “COUNTER-OFFENSIVES” , but the recent “raid on Kursk Oblast” does not give any particular reason for optimism).

“You can't put your head on someone else’s shoulders.” - I see again and again how our leadership's “own desires” become “a guideline for formulating an analytical picture and a point of application of efforts, regardless of their correspondence to the actual situation.”

The leadership wants a “compromise peace on its own terms”? - This means that all other possible developments are ignored (as are the measures necessary to be carried out in “unplanned cases”).
Well, we have already observed the results of such “reality planning from above” in 2014 (in Donbass), 2015 (in Syria), 2022 (twice - at the beginning of the SVO and during the pathetic attempts to get out of it through the “Istanbul agreements”). We are observing them now... What all this will ultimately lead to - I have already written and said, probably, hundreds of times. I will not repeat myself.
With respect and gratitude, I. V. Girkin

https://t.me/RDS_Official_channel/6238

14,505 posted on 04/05/2025 5:01:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14503 | View Replies]

To: blitz128
😎🔥 Destruction of Russion troops and logistics by 3rd Assault Brigade!

https://x.com/Maks_NAFO_FELLA/status/1908454010304016650


14,506 posted on 04/05/2025 5:05:58 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14504 | View Replies]

To: PIF
Kadyrov’s men filmed their "harsh daily life" on video, but this time not for TikTok. Their commander is dead, and a Ukrainian "Baba Yaga" drone is hitting their positions. The trench situation looks far from ideal for Putin’s so-called "heroes."

https://x.com/wartranslated/status/1908479655977373697


14,507 posted on 04/05/2025 5:15:43 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14506 | View Replies]

To: AdmSmith; All
It's amazing that I. V. Girkin is allowed to post from his prison cell.

It appears that pootin is willing to fight a war of attrition and Girkin is having no part of it.

AdmSmith's post above is recommended reading for all.

14,508 posted on 04/05/2025 5:23:06 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14505 | View Replies]

To: PIF
😍🔥

Thanks to a precise drone drop, the 🇺🇦 Peaky Blinders foiled a 🇷🇺 Russian attempt to assault on motorcycles.

The result was -5 🇷🇺 🐷

https://x.com/GloOouD/status/1908463173675463104


14,509 posted on 04/05/2025 5:28:43 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14508 | View Replies]

To: PIF
🔥 The 🇷🇺 Russian command began to send their single-use orcs to storm 🇺🇦 Ukrainian positions with TM-62 anti-tank mines in the open field.

New tactic or another act of suicide?

https://x.com/GloOouD/status/1908431268594720825


14,510 posted on 04/05/2025 5:32:06 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14509 | View Replies]

To: AdmSmith; All
Meanwhile, a full-blown tantrum is raging in Russian Z-channels about a wrecked optical fiber plant. None of them can figure out how it happened and are tripping over themselves trying to sort out who’s actually to blame.

https://x.com/wartranslated/status/1908506507517305034


14,511 posted on 04/05/2025 6:23:45 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14510 | View Replies]

To: JonPreston; blitz128; marcusmaximus; AdmSmith; gleeaikin
🍈 : "Ruzzia has never invaded France or England.
Yet NATO Neocons such as you shake in fear of Russia marching Westward."

Russians have often "marched Westward", including:

  1. 1700-1722 -- Russian armies invaded Sweden, Finland, Estonia, Latvia, Lithuania, Poland, Ukraine, Germany, Moldova & Belarus.

  2. 1758 - 1760 -- Russians invaded British-ally Prussia, fought several battles and occupied Berlin.

  3. 1783 -- Russians invaded Turkey, annexing Crimea.

  4. 1799 -- Russians invaded Italy and defeated the French at Novi.

  5. 1799 -- Russians fought the French near Zurich, Switzerland.

  6. 1805 -- Russian forces attacked the French at Austerlitz, Austria.

  7. 1806 -- Russian army fought the French at Pułtusk, Poland.

  8. 1807-1812 Russians fought Brits in the Anglo-Russian War

  9. 1807 -- Russian army attacked the French at Friedland, Prussia.
The list goes on and on, including recent Russian invasions of Moldova, Georgia, Ukraine, Syria & others -- Russian forces invading neighboring countries and fighting against allies of western powers like France, Britain, Germany, Austria & Turkey.

🍈 : "It's almost as nonsensical as your fear of global warming."

What are even more nonsensical than your ridiculous denials are your ludicrous accusations, comrade.

14,512 posted on 04/05/2025 6:45:41 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 14456 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Ceasefire Broken! Ukrainians Obliterate Russian Bases in Immediate Response! ]

Today [ Apr 04, 8 pm ], there is important news from the Russian Federation.

Here, just a week after it was signed, Russia shattered the energy ceasefire with a massive wave of missile and drone strikes aimed at Ukrainian power plants. In response, Ukraine unleashed a powerful retaliation, not targeting Russian energy infrastructure, but instead aimed straight at Russian strategic airbases.

The recent statements of the press secretary of the Russian president, Dmitry Peskov, officially stated that Russia reserves the right not to follow the ceasefire, as he added that Russian strikes against Ukrainian energy facilities will persist, claiming that Ukraine violated the ceasefire first.

Russia had already drawn the ceasefire into question, demanding the removal of sanctions on state-owned Russian banks and financial institutions, as an additional prerequisite for the ceasefire, despite it already having been signed. Peskov also claimed that the European Union’s refusal to lift sanctions on Russia, indicates the unwillingness to put an end to the war, regardless of whether Russian demands were made in hindsight.

To create a justification for their own violation of the ceasefire, Russian forces staged a false flag attack in the Kursk region, where they sabotaged the Sudzha gas measuring station, framing it as a Ukrainian air strike that broke the agreement.

Interestingly, Ukrainians cut off the flow of Russian gas through this pipeline in January, and Russian infantry used the empty pipes to try and infiltrate into Sudzha, after which Ukrainians destroyed the pipe and everyone in it with cluster munitions and artillery.

As Ukrainians never restarted the gas transit, there was no reason for Russians to repair the pipes and restore gas flow to the Sudzha measuring station, other than to instigate a false-flag sabotage operation.

Despite this, Russians used it as a justification to once again restart their drone and missile strikes against Ukrainian energy infrastructure, launching 43 missiles and 74 drones, of which the Ukrainians intercepted 30 and 47, respectively.

The Russian Ministry of Defense outright stated they launched the attack targeting Ukrainian military energy infrastructure, as the remaining missiles and drones inflicted severe damage, forcing the temporary shutdown of some parts of the Ukrainian power grid, as civilians in towns and cities in many regions were left without electricity, amidst freezing nightly temperatures.

Unfortunately for Russians, Ukrainians are actively refraining from breaking the energy ceasefire themselves as a response, hoping to show the international community which side is the aggressor. However, in retaliation, Ukrainians instead targeted Russian strategic military targets, to disarm Russian striking capabilities, and prevent further damage to Ukrainian energy facilities.

Ukrainians launched a drone strike against the Shaykovka airbase in the Kaluga region, where Russian strategic Tu-22 bombers are located. This airbase is also one of just 2 Russian airbases operating the scarce Tu-22 jets near Ukraine, to be used as a refueling and rearming point for Russian aircraft conducting strikes.

Ukrainians targeted Russian missile depots, fuel storages, and aircraft maintenance facilities to undermine future Russian strike capabilities, and possibly destroy Russian strategic bombers that landed just after their strikes on Ukrainian energy infrastructure, showing the quick response capabilities of the Ukrainians.

As you remember, before the energy ceasefire was ratified, Ukrainians also struck the Engels airbase, destroying 96 cruise missiles and undermining three large missile strikes Russians had planned for late March, which prevented them from being launched.

While preliminary reports do not show the exact results of the Shaykovka airbase strike, undoubtedly, Ukrainians have undermined, if not outright prevented, another series of Russian missile strikes.

Overall, the Russians are trying to fully cancel the ceasefire agreement, and used a false flag sabotage operation as justification to restart their missile strikes against the Ukrainian energy sector, which caused power outages across Ukraine. In retaliation, rather than target energy infrastructure themselves, Ukraine sought to disarm Russian strike capabilities, targeting strategic Russian airbases.

In his evening address, President Zelensky stated that for several weeks now, they have had the American proposal for an unconditional ceasefire.

And almost every day, in response to this proposal, there are Russian drones, bombs, and missiles striking Ukrainian cities.

He underlines how the attacks demonstrate an unwillingness to seek a lasting peace, urging further international pressure and sanctions on Moscow, and more air defense to counter Russian airstrikes, compelling Russia to negotiate.

https://www.youtube.com/watch?v=xEgmcpC2ZOo


14,513 posted on 04/05/2025 6:58:29 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14500 | View Replies]

To: BeauBo; AdmSmith; FtrPilot; PIF; blitz128; BroJoeK; Bruce Campbells Chin; buwaya

With those oil benchmarks now well below $70 a barrel oil, and WTI even close to $60, I wonder how many of the major Oil Babies will actually want to “drill, baby, drill”? How much bidding on leases, and then actually starting to develop them is currently happening, or likely to happen any time soon? Has pumping on shut down Dakota fracked wells restarted or is more planned any time soon? Would actual peace in Ukraine cause oil prices to rise again in the near future.

What has been or is likely to be the influence of the current tarrifs excitement likely to be? Yesterday, the Dow actually had dropped to the mid 38,000s. Will it go lower, or are countries quickly lining up to balance their trade situations with ours? Is this a good time to buy, or to wait and see for a few weeks?


14,514 posted on 04/05/2025 7:29:55 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14486 | View Replies]

To: FtrPilot

Time for 🍈to post his President Trump hating meme😂


14,515 posted on 04/05/2025 7:29:57 AM PDT by blitz128
[ Post Reply | Private Reply | To 14504 | View Replies]

To: BroJoeK
More rantings from a Neocon lunatic

From Grok

As of April 5, 2025, Russia has not engaged in a broad westward conquest.

The idea of "westward conquest" typically implies a significant expansion of Russian territory or influence into Western Europe or NATO-aligned countries. However, Russia’s military efforts have been focused primarily on Ukraine, with no clear evidence of a broader westward push into other nations.

Historically, Russia’s westward ambitions have been a concern for the West, yet, current evidence suggests its

So, no, Russia hasn’t moved westward in a significant conquest, not launching a wider westward offensive.

14,516 posted on 04/05/2025 7:33:09 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14512 | View Replies]

To: BeauBo; central_va

Could it be that OPEC is increasing production because they are happy to stick it to Russia?


14,517 posted on 04/05/2025 7:35:22 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14487 | View Replies]

To: blitz128; LowIQ
Is this where the NeverTrump support movement meets?


14,518 posted on 04/05/2025 7:38:38 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14515 | View Replies]

To: BroJoeK
Does Neocon, NeverTrump Max Boot still have a job?


14,519 posted on 04/05/2025 7:41:26 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14516 | View Replies]

To: blitz128
My points still stand

Still arguing with AI?

This is a new level of stupid, even for you


14,520 posted on 04/05/2025 8:09:50 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14496 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,481-14,50014,501-14,52014,521-14,540 ... 22,401 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson