Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,761-12,78012,781-12,80012,801-12,820 ... 22,481-22,496 next last
To: PIF

The Wehrmacht could of only hoped for such a stronk leader, 3 years😎


12,781 posted on 03/04/2025 12:14:55 PM PST by blitz128
[ Post Reply | Private Reply | To 12778 | View Replies]

To: BroJoeK

The difference between ww2 and now is the Soviets had a lot more help than they are getting now, and after 3 years their military is not stronger and more successful than when it started this war.

Numbers are an interesting thing😎


12,782 posted on 03/04/2025 12:20:42 PM PST by blitz128
[ Post Reply | Private Reply | To 12775 | View Replies]

To: blitz128

we helped the Soviets in WWII and now we are helping them again


12,783 posted on 03/04/2025 1:08:52 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12782 | View Replies]

To: PIF

We will see, sadly everyone is helping out Russia with the addiction to their petro products.

Let’s see after mineral deal is signed


12,784 posted on 03/04/2025 3:15:55 PM PST by blitz128
[ Post Reply | Private Reply | To 12783 | View Replies]

To: PIF

My point was we supplied the Soviets to defeat the Germans, without this aid it is doubtful theu would have done as “well”as they did.

Regardless throwing bodies at the problem is an age old Russian strategy


12,785 posted on 03/04/2025 3:17:47 PM PST by blitz128
[ Post Reply | Private Reply | To 12783 | View Replies]

To: blitz128
In just a few days, the 63rd Mechanized Brigade near Lyman burned down Russian equipment: 2 armored vehicles, 2 Kamaz trucks, UAZ with ammo, a motorcycle, 2 guns, an AA system, 4 mortars, and an EW unit.

https://x.com/NOELreports/status/1897241757852844278


12,786 posted on 03/05/2025 3:17:33 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12785 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Biggest Push Yet! Half of the City Retaken! Russian in Panic! ]

Today [ Mar 04, 8 pm ], there are a lot of important updates from the Toretsk direction [ north of Avdiivka ].

Here, Ukrainian forces are tightening the noose around Russian positions in Toretsk, advancing deep into the city with a well-executed pincer maneuver.

What started as a series of targeted raids has now turned into a counteroffensive, rapidly undoing months of Russian gains.

The goal of the Ukrainian forces in this area is to retake the initiative from the Russians and re-establish control of Toretsk. This is because Russians are trying to advance past Toretsk and set conditions for a future offensive effort toward Kostyantinivka to the north.

To deny the Russians complete control of Toretsk, the Ukrainians utilized their powerful fortifications near the northern coal mine and around the terrikons [ mine waste piles ] to the west as staging grounds for raids deep into the city. This way, the Ukrainians could constantly disrupt the Russian plans as they destroyed the Russian positions and eliminated their soldiers in isolated holdouts.

Ukraine’s key advantage in this area is its complete fire control over Toretsk using drones. This forces Russian troops to move in small squads, staying hidden in buildings and basements to avoid strikes.

The situation is worsened by the constant threat of Ukrainian kamikaze drones, which prevent even tanks and armored vehicles from providing fire support. As a result, Russian soldiers in the city are effectively unable to engage openly, fearing immediate drone attacks.

Russia’s failure to establish fire control over Toretsk’s main supply road has allowed Ukraine to maintain a steady flow of logistics, reinforcements, and heavy equipment into the town. As you remember from the previous report, Russians have had to halt their close air support operations, due to Ukrainians transferring additional man-portable air defense systems into the area.

Geolocated combat footage shows how a squad of Ukrainian soldiers dismounted from an armored car and approached a Russian position in a residential building. The Ukrainians suppressed the position with intense machine-gun fire, allowing them to place several packages of tied together TM-62 anti-tank mines at the Russian position before safely returning to their vehicle.

As they exfiltrated the area, the Russian stronghold within the house and the basement were destroyed in the massive explosion that followed, eliminating anyone hiding inside, while the Ukrainian squad took 0 casualties.

After expanding the gray zone through constant raids like this, Russian control over central and northern Toretsk, aside from the high-rise district, had quickly deteriorated. Most of the city consists of destroyed one-story houses, forcing Russian troops to hide in basements to avoid Ukrainian kamikaze drones, leaving them unable to mount an effective defense.

This allowed Ukrainian forces to raid, suppress, and eliminate Russian positions with explosives. Additionally, the high-rise district was so severely damaged that Russian troops could only establish minimal, ineffective firing positions, preventing them from enforcing fire control.

As the Ukrainians gradually destroyed Russian positions one by one, they were able to advance progressively further into the city center. Geolocated combat footage recently shared by Russian soldiers shows a Ukrainian armored vehicle operating in and rotating an assault unit all the way near the coal mine close to the city center, revealing how far Ukrainian positions stretch in reality.

Additional geolocated footage shared by Ukrainian soldiers shows how Ukrainian soldiers even already maintain consolidated positions in the high-rise district. The footage shows how 1 Russian soldier attempted to conduct a similar raid to blow up the Ukrainian position. However, as he was sent alone and without support, he was quickly eliminated and finished off by small arms fire and a kamikaze drone strike.

Overall, the Ukrainian advance through localized raids managed to expand the gray zone and drive Russians out from a large part of Toretsk. Russians have already lost over 12,000 soldiers trying to take Toretsk, which, along with the Ukrainian advances, indicates that Russians might now instead be suffering from personnel shortages, turning the tables and allowing Ukrainians to take advantage of gaps in the line instead.

With the recently released footage showing the depth of Ukrainian operations into previously Russian-controlled streets, Ukrainians will likely be able to consolidate even more tactically important positions, undoing months of Russian progress.


12,787 posted on 03/05/2025 3:19:56 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12786 | View Replies]

To: PIF
At night, Ukraine's Air Force again repelled a large Russian missile and drone attack.

Shot down:
?/3 Iskander-M/KN-23 ballistic missiles
?/1 S-300 ballistic missile
115/181 Shahed drones

In addition, 55 Russian drones were supressed by electronic warfare. Since a short while, Ukraine's Air Force does not always report the results of combat operations against Russian missiles.

https://x.com/NOELreports/status/1897203538981273692


12,788 posted on 03/05/2025 3:22:06 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12786 | View Replies]

To: PIF
PIF: "Well, we hope, positive forecasts will continue to come true."

Obviously, from your post it's clear: Russians crave recognition by Pres. Trump that Russia has now returned to world super-power status, and as of today, they think they are getting it.

But I think, before this is all over, Russian's will pay a huge price for whatever recognition Pres. Trump grants them.

12,789 posted on 03/05/2025 4:28:56 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 12778 | View Replies]

To: BroJoeK

3 years into this war against a much smaller country in all respects and this is what a “super power” has accomplished?

He will claim what he wants but doesn’t make it so.


12,790 posted on 03/05/2025 4:34:25 AM PST by blitz128
[ Post Reply | Private Reply | To 12789 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, March 4, 2025

Ukraine has significantly expanded its defense industrial production capabilities throughout the war in an effort to eventually meet its military needs independently, but Ukraine’s ability to become self-sufficient in the long-term is contingent on continued support from partner states in the short- and medium-term. Ukrainian Prime Minister Denys Shmyhal stated on March 4 that Ukraine currently domestically produces about 33 percent of the weapons Ukraine uses on the battlefield and currently produces $35 billion worth of weapons and ammunition annually — exceeding the production capabilities of many of Ukraine’s partners.[18] Shmyhal stated that Ukraine should be able to meet at least 50 percent of its total military needs by the end of 2025, with Ukraine meeting all of its artillery system needs and much of its 80mm and 120mm mortar shell and 105mm, 122mm, and 155mm artillery shell requirements. Shmyhal stated that Ukraine has significantly increased its defense production since 2023 - tripling its artillery production, increasing its ammunition production by a factor of 2.5, doubling its production of anti-tank weapons, and increasing its production of armored personnel carriers fivefold. Shmyhal emphasized that Ukraine currently domestically produces nearly all of the air-, sea-, and ground-based drones that Ukrainian forces use in combat operations. Shmyhal previously stated that Ukraine increased its drone production tenfold in 2024 and invested an additional 7.9 billion hryvnia (about $189 million) to boost drone production in 2025.[19] Shmyhal stated that Ukrainian state-owned defense enterprise manager Ukroboronprom has grown to become one of the 50 most productive defense companies in the world.[20] Shmyhal credited European investments in the Ukrainian defense industry for much of Ukraine’s defense industrial growth, especially the Danish initiative for joint defense production initiatives.[21] Shmyhal stated that Ukraine attracted nearly $1 billion in European defense investments in 2024, including $351 million from Denmark, $436 million from the EU, $67 million from the UK, and $45 million from Norway. Shmyhal stated that Ukraine has created a number of joint defense enterprises with European states, especially with the UK and Germany. Shmyhal stated that at least three international defense companies have provided licenses for Ukraine to start producing NATO- and EU-standard weapons within Ukraine. Ukraine has dramatically built out its defense industrial base (DIB) since 2023 but still requires investments and time to reach full self-sufficiency.[22] ISW continues to assess that Ukraine’s prospects for sustaining its military needs in the future with limited foreign assistance are excellent.[23] Ukraine’s DIB expansion continues to rely on monetary investment from partner states, and continued military assistance from partners gives Ukraine the time to continue to develop its DIB towards self-sufficiency.

The Ukrainian Parliament (Verkhovna Rada) and Ukrainian President Volodymyr Zelensky reiterated on March 4 Ukraine’s commitment to work with the Trump Administration to achieve a sustainable and lasting peace in Ukraine. Verkhovna Rada leadership and parliamentary factions and groups issued a joint statement welcoming Trump’s efforts to begin peace negotiations and reiterating the need to develop a strategic partnership with the United States through the US-Ukraine mineral deal.[24] Zelensky stated that Ukraine is ready to come to the negotiating table “as soon as possible to bring lasting peace closer.”[25] Zelensky added that he and his administration are ready to “work under President Trump’s strong leadership” to achieve a lasting peace and proposed a partial ceasefire between Ukraine and Russia to advance a possible peace settlement. Zelensky offered for Ukraine and Russia to release prisoners of war (POWs), to ban missile and long-range drone strikes against energy and civilian infrastructure, and to reach an immediate truce in the Black Sea. Zelensky thanked the United States for its support of Ukraine’s sovereignty and independence, expressed regret over the meeting with Trump at the White House on February 28 that “did not go the way it was supposed to,” and reiterated Ukraine’s readiness to sign the mineral deal. Russian President Vladimir Putin notably has not made any ceasefire offers since Trump assumed office on January 20. Kremlin officials instead formally rejected the possibility of a ceasefire on any terms other than Ukraine’s and the West’s complete capitulation in late February 2025.[26]

The high casualties in Russia’s war in Ukraine are the direct result of Putin’s determination to conquer all of Ukraine using horrific and costly tactics, and Putin can dramatically reduce this killing any time he chooses. Russian forces have been conducting highly attritional, infantry-led assaults along the frontline that result in high losses but only return disproportionately limited territorial gains.[27] Putin claimed in June 2024 that Russia is unable to secure a rapid victory in the war and so Russian forces are instead pursuing a more gradual victory.[28] Putin claimed at the time that Russian forces are trying to “squeeze” Ukrainian forces out “of those territories that should be under Russian control.” Putin is committed to gradual, creeping gains at the expense of high losses and likely believes that these limited gains can set conditions over time for Russia to demand more Ukrainian territory during future peace negotiations or allow him to conquer Ukraine entirely. Putin’s desire to continue this deadly approach is driving the high loss rates on the battlefield. Russia is also conducting nightly drone and missile strikes against rear Ukranian areas that are killing civilians and destroying and damaging Ukrainian civilian and energy infrastructure – further increasing the death toll in the war in Ukraine.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-4-2025


12,791 posted on 03/05/2025 4:42:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12752 | View Replies]




12,792 posted on 03/05/2025 4:47:26 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12708 | View Replies]

To: AdmSmith
Day 1105 of the Russian invasion. 1,250, i.e. more than 52 Russians and Norks/h. Vehicles and fuel tanks more than 130% above the average.


12,793 posted on 03/05/2025 4:57:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12754 | View Replies]

To: piasa; PIF; FtrPilot; BroJoeK
Кремлевская табакерка

Putin showed the Prime Minister of Myanmar crosses with his initials. According to the President, they are especially effective against American and British missiles.

We wrote : special pectoral crosses with Vladimir Putin's initials were blessed for the fighters of the SVO. According to sources in the Kremlin, the President had several blessed crosses with him during the meeting with the Prime Minister of Myanmar, which have not yet been sent to the front. And he showed them to the foreign guest. “You said that I am the King of Russia (this is how the Prime Minister of Myanmar called Vladimir Vladimirovich at the meeting, - ed.). This, of course, is not true, but we have some attributes of the monarch's power, we value historical continuity. Here are the crosses with my initials. They are being sent to the front, and they really protect our fighters. We have already sent more than 100 crosses,” Putin said.

Vladimir Vladimirovich emphasized that earlier his initials were put on chains of crosses and body icons that were given to the military. But this, according to him, “was not so effective.” The consecrated objects did not protect all the soldiers; some of them died ( we wrote about this ). The death of soldiers with crosses that have the president's initials on them is “no more than isolated cases.” Putin added that, according to the soldiers, the crosses with his initials are “especially effective” in protecting against British and American missiles.

The Prime Minister of Myanmar, sources noted, was impressed. And he accepted one of the crosses as a gift, as a “beautiful Russian souvenir.”

https://t.me/kremlin_secrets/5370

Why do today's decision-makers in the Kremlin believe this?
The explanation is that they are continuing the traditions of the Moscovite Russia. In Muscovite Russia, supernaturalism was a fundamental part of daily life.

See Orthodox Russia, Belief and Practice Under the Tsars Edited by Valerie A. Kivelson, and Robert H. Greene
https://www.psupress.org/books/titles/0-271-02349-X.html

This means we should stop calling the country Russia and switch to saying Muscovy.

The Principality of Moscow or Muscovy (1263–1389), later the Grand Principality of Moscow (1389–1547), was a medieval Russian principality. Its capital was the city of Moscow. https://en.wikipedia.org/wiki/Principality_of_Moscow

12,794 posted on 03/05/2025 5:27:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12494 | View Replies]

To: BroJoeK; PIF; BeauBo; blitz128; FtrPilot; AdmSmith; MalPearce

I recently saw information about a new possible source of mini-nuke plant production. There was a significant change in the designation of Thorium saying it was no longer considered so dangerous as uranium and plutonium in nuclear plants. Apparently disposal of Thoriium’s used fuel would not have the large problems connected with uranium and plutonium fuels. I have not had time to do a deeper dive on this issue, but perhaps one of you might find it interesting to explore.

Apparently there are large amounts of Thorium lying in mine tailings of certain fertilizer extraction sites, as well as other valuable wastes from those US sites. Extracting the Thorium and other valuable minerals from such sites could eventually be a good business here. I wonder if places like Ukraine have similar mining wastes suitable for future extraction. Certainly labor costs are far lower in Ukraine and they have shown amazing creativity in useful/useable production with their drone and other manufacturing activities. Certainly development of new energy sources with much lower danger potential is something that would be of value both here and in Europe, and good potential business and investment. Energy needs will only continue to increase as more data centers are built and Bitcoin and the like are produced.


12,795 posted on 03/05/2025 5:38:57 AM PST by gleeaikin (oo)
[ Post Reply | Private Reply | To 12775 | View Replies]

To: gleeaikin

Mountain Pass Rare Earth Mine: In 2020 the mine supplied 15.8% of the world’s rare-earth production. It is the only rare-earth mining and processing facility in the United States. It contains 8% to 12% rare-earth oxides, mostly contained in the mineral bastnäsite.
https://en.wikipedia.org/wiki/Mountain_Pass_Rare_Earth_Mine


12,796 posted on 03/05/2025 6:21:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12795 | View Replies]

To: AdmSmith; PIF

The growth in Ukraine’s ability to produce drones and other means of self protection is impressive. Glad to see European countries are supporting this development. It appears Ukraine can eventually become a good source for rearmament of Europe and NATO. I noted that Zelensky visited a military goods factory in PA during his recent visit and congratulated and thanked the workers for their efforts. I wonder if our President is aware of the rate of Ukraine’s growth in self-defense? I also wonder how well Ukraine’s military production compairs with our own such production and OUR rate of increase in shells and other important materiel?

The report on Putin’s visit with the Myanmarr Prime Minister is interesting. The PM very diplomatically accepted the cross signed by Russia’s dictator. However given a likely difference in religious beliefs, I wonder if he was impressed. Given the number of Russians their leader sends daily to their unnecessary death, the crosses seem to be in short supply, even if they were effective as believed. Perhaps one of these crosses would give the soldier that little bit of extra hope and energy needed to escape almost certain death in one of these “meat waves.” With over 1,000 casualties today and apparently every day, it appears their leader should be spending every waking hour signing these crosses to save his “beloved” sacrifices. What a weird form of Christianity he displays. But I guess going to the right place after you are killed is the most important thing. On the other hand it did not prevent this Christian from destroying the nice cemetery Prigozhin had created to honor the service of his dead Wagners and comfort their families. What kind of monster does that to the people who died to serve the motherland and their families. I wonder if our President knows his old “friend” and prospective business partner did that?


12,797 posted on 03/05/2025 6:23:32 AM PST by gleeaikin (oo)
[ Post Reply | Private Reply | To 12791 | View Replies]

To: gleeaikin

Yes, you can use Thorium in nuclear power plants, but regulations and supply chains are a decade away. It’s 100% uranium until then.


12,798 posted on 03/05/2025 6:29:53 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12795 | View Replies]

To: JonPreston

12,799 posted on 03/05/2025 7:07:45 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12751 | View Replies]

To: JonPreston

12,800 posted on 03/05/2025 7:08:39 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12799 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,761-12,78012,781-12,80012,801-12,820 ... 22,481-22,496 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson