Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,861-11,88011,881-11,90011,901-11,920 ... 19,261-19,263 next last
To: BeauBo

Is patton heading one😎


11,881 posted on 02/13/2025 1:15:30 PM PST by blitz128
[ Post Reply | Private Reply | To 11877 | View Replies]

To: blitz128; PIF
🍈

🚨🇺🇸 TRUMP ORDERS MASS FIRING OF NEW FEDERAL HIRES WITHIN 48 HOURS

Administration directs immediate termination of most probationary employees, impacting up to 220,000 workers hired in past two years.

Agencies began layoffs Thursday through pre-recorded videos and group calls.… pic.twitter.com/TIe8f7zajq— Mario Nawfal (@MarioNawfal) February 13, 2025


11,882 posted on 02/13/2025 5:08:28 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11881 | View Replies]

To: JonPreston

🚨 NEW: Russian President Putin has invited President Trump to MOSCOW for Russia's Victory Day Parade

pic.twitter.com/MTGXfkVB7V— Eric Daugherty (@EricLDaugh) February 13, 2025


11,883 posted on 02/13/2025 5:18:28 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11882 | View Replies]

To: BroJoeK

11,884 posted on 02/13/2025 5:33:07 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11883 | View Replies]

To: JonPreston

Did you see this ?

https://x.com/WarClandestine/status/1890140363769409744


11,885 posted on 02/13/2025 7:54:42 PM PST by ANKE69 (✌️🇺🇲 Let's MAGA)
[ Post Reply | Private Reply | To 11884 | View Replies]

To: JonPreston
LOL !!
Just noticed you've posted it. 👍

IMG-5243
11,886 posted on 02/13/2025 7:59:53 PM PST by ANKE69 (✌️🇺🇲 Let's MAGA)
[ Post Reply | Private Reply | To 11884 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 13, 2025

Russia reportedly lost just over 5,000 tanks and armored vehicles during 2024 compared with 3,000 in 2023. The British International Institute for Strategic Studies (IISS) estimated on February 10 that Russia lost 1,400 main battle tanks (roughly four tank divisions’ worth) and over 3,700 infantry fighting vehicles (IFVs) and armored personnel carriers (APCs) — totaling 5,100 lost tanks and armored vehicles in 2024.[6] Data from the Ukrainian General Staff indicates that Ukrainian forces damaged or destroyed over 3,000 Russian tanks and almost 9,000 armored vehicles in 2024, and IISS’ estimates likely only account for destroyed tanks and armored vehicles.[7] IISS assessed in February 2024 that Russia would be able to sustain its then-rate of vehicle losses (over 3,000 tanks, APCs, and IFVs annually as of 2023) until February 2026 or 2027 by refurbishing vehicles from Soviet-era storage facilities.[8] It remains unclear if the Russian military command will remain willing or able to sustain this increased rate of armored vehicle losses in 2025, as Russian forces appear to be adapting their tactics to limit such losses.

IISS noted that Russia has adapted some of its tactics to address ongoing equipment shortages and is increasingly relying on infantry-led assaults to advance along the frontline.[9] ISW began observing indications in November and December 2024 that Russian forces were using fewer armored vehicles in Donetsk Oblast, particularly in areas where Russian forces had previously relied heavily on mechanized assaults to make significant tactical advances.[10] Russian forces have continued to use fewer armored vehicles in Donetsk Oblast and throughout the frontline, possibly due to Ukrainian drone operations, equipment constraints, or non-conducive ground conditions brought about by rainy weather. Khortytsia Group of Forces Spokesperson Major Viktor Trehubov stated on February 13 that successful Ukrainian drone strikes have been the main factor — and not poor weather and ground conditions — prompting Russian forces to use fewer armored vehicles along the frontline.[11] Trehubov noted that Russian forces also have issues supplying shells to some unspecified frontline positions, possibly due to successful Ukrainian strikes against Russian ammunition depots, and have thus decreased the intensity of shelling in such areas.

It remains unclear if Russia can repair and newly-produce a sufficient number of tanks and armored vehicles to replace losses in Ukraine and equip new Russian units. IISS assessed that Russia refurbished and built over 1,500 tanks and 2,800 IFVs and APCs in 2024 — suggesting that Russia produced enough vehicles to replace all of its tank losses and three quarters of its armored vehicle losses last year.[12] IISS assessed that Russia's ongoing effort to expand the Russian military and create new units is exacerbating equipment shortages and noted that Russia may also be suffering from a shortage of spare parts to refurbish tanks and armored vehicles. IISS assessed that it is highly likely that the Soviet-era tanks and armored vehicles remaining in Russia's stores are in a deteriorated condition, which may complicate Russia's ability to offset high equipment losses in 2025 and beyond. Ukrainian President Volodymyr Zelensky, citing Ukrainian intelligence, reported on February 8 that Russia is continuing to form new divisions, and former Russian Defense Minister and Security Council Secretary Sergei Shoigu announced in January 2023 that Russia aimed to stand up 14 new military divisions in the coming years.[13] The Russian military command appears to be balancing allocating refurbished and newly-produced vehicles between new formations and formations that have been fighting on the frontline for several years. Russia may struggle to adequately equip its units with materiel in the long-term if the Russian military continues to burn through Soviet-era vehicle stocks without significantly increasing Russia's ability to produce new tanks and armored vehicles.

Estonia's Foreign Intelligence Service (EFIS) assessed that Russia is attempting to build its capabilities not only to support Russia's war effort in Ukraine but also to prepare for a potential future war with NATO, which is consistent with ISW’s assessments about ongoing Russian efforts to prepare its military and society for a future conflict with NATO in the medium to long-term. The EFIS published its annual intelligence report on February 12 which focused on Russian threats to Estonia, other NATO members, and the West.[14] The intelligence report noted that the pace of the Russian military's rearmament will depend on the duration and outcome of Russia's war in Ukraine. The EFIS also assessed that a cessation or freeze of the war in Ukraine on terms favorable to Russia would allow Russia to permanently station more forces along the borders of NATO member states neighboring Russia than before Russia's full-scale invasion of Ukraine in February 2022 – consistent with ISW’s longstanding assessments.[15] The intelligence report highlighted Russia's efforts to increase, improve, and centralize drone operations and production.[16] The EFIS reported that Russia will allocate on average one million euros (about $1 million) annually until 2030 to its “Unmanned Aerial Vehicle” National Project, established in December 2023, which aims to establish 48 research and production centers across Russia, standardize drone productions and development, create an electronic database of drone industry experts, and integrate drone-related education into 75 percent of all Russian schools.[17] The EFIS assessed that Russia is attempting to use these research and development centers to reduce Russia's reliance on Western and foreign technology and components and that Russia continues to rely on the People's Republic of China (PRC) to procure Western components for drone production. The EFIS noted that up to 80 percent of sanctioned Western components likely reach Russia through the PRC.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-13-2025

11,887 posted on 02/13/2025 11:52:47 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11824 | View Replies]

1,200 i.e. more than 50 Russians and Norks/h. Vehicles and fuel tanks more than 320% and artillery more than 250% above the average.


11,888 posted on 02/13/2025 11:57:26 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11826 | View Replies]

To: PIF; FtrPilot; BeauBo; blitz128
Кремлевская табакерка

The FSB will investigate the Russian National Guard, the Federal Protective Service, and “destructive elements” at the front

According to our sources in the service, such an order was received from the Kremlin. They demand “to identify destructive elements that have used and are using the SVO [war in Ukraine] for enrichment, solving personal issues, and achieving other selfish goals.” “We have received signals that such elements exist in the FSO, the Russian National Guard, and among a number of ethnic groups that participate in the SVO. Plus, we will investigate other abuses. The principle of ‘War will write off everything’ will soon cease to apply. Everyone should understand this,” the channel's source in the FSB said.

At the same time, he refused to say whether this order is connected with possible peace talks with the Americans on the Ukrainian crisis. “This is all politics. We have been instructed to identify internal enemies who use the SVO. That's it. Don't look for a double bottom here,” another source in the service said on this matter.

https://t.me/kremlin_secrets/5289

11,889 posted on 02/14/2025 12:06:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11880 | View Replies]

24JAN2025 Putin wants to restart nuclear arms cuts talks, Kremlin says after Trump comment.

Russian President Vladimir Putin has made clear he wants to restart nuclear arms cuts talks as soon as possible, the Kremlin said on Friday in response to comments by U.S. President Donald Trump.
Trump said on Thursday he wanted to work towards cutting nuclear arms, adding that he thought Russia and China might support reducing their own weapons capabilities.
Kremlin spokesman Dmitry Peskov said the ball was in Washington's court.

https://www.reuters.com/world/putin-wants-restart-nuclear-arms-cuts-talks-kremlin-says-after-trump-comment-2025-01-24/

US President Donald Trump says he wants to meet with Chinese President Xi Jinping and Russian President Vladimir Putin to discuss cutting back nuclear weapons.

Trump referred to nuclear arms while speaking to reporters at the White House on Thursday.

https://www3.nhk.or.jp/nhkworld/en/news/20250214_10/

The reason is that only a small part of the Russian nuclear weapons are operational.

11,890 posted on 02/14/2025 12:26:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11889 | View Replies]

To: PIF; FtrPilot; BeauBo; gleeaikin; blitz128
🍈 Quoting Sprinter Observer @SprinterObserve:

"Zelensky refused to sign the agreement on rare earth metals"

Hardly:

"Zelenskyy noted that Ukraine had "received the first draft of the appropriate document on the partnership between our nations".
"We've received this document today; we... will do everything so that our teams can really quickly agree and sign this document," he added."
Negotiations are ongoing.
Secretary Bessent's draft proposal did include both economic relations and US military aid.

🍈 : "The Ukrainian president had hoped for a personal meeting with Trump to discuss a "broad vision of the world," but instead he was offered a "financial deal." "

Naw.

In his meeting with Bessent, Zelensky said nothing about a "broad vision of the world."
Bessent's draft proposal did include security assistance for Ukraine.

"For his part, Bessent told reporters that the document is part of additional guarantees from the US to Ukraine and serves as "an important signal to the Russian leadership that we stand together" in economic cooperation with Ukraine."
What's clear is that Euros will need to step-up big-time, if they want to prevent Ukraine's ultimate collapse.
11,891 posted on 02/14/2025 2:36:16 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11837 | View Replies]

Containerized SAM System That Fires Soviet Air-To-Air Missiles For Ukraine Breaks Cover
The Anglo-Danish Gravehawk with its repurposed R-73 missiles is the latest improvised effort to bolster Ukraine’s air defense arsenal.
https://www.twz.com/land/containerized-sam-system-that-fires-soviet-air-to-air-missiles-for-ukraine-breaks-cover


11,892 posted on 02/14/2025 2:57:12 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11890 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Triple Disaster! Russians Exposed Their Flanks And Paid For It ]

Today [ Feb 13, 8 pm ], there is a lot of news from the Siversk direction.

Here, the Russian offensive operation to finally reach Siversk faces a battle-hardened Ukrainian stronghold, manned by experienced veterans.

To overcome it, the Russian commanders launched a large-scale mechanized attack on 3 vectors, only for Ukrainians to completely annihilate each one of them.

The Russian goal is clear: they must capture Verkhnokamianske at any cost, to pave the way for a larger offensive toward Siversk. This crucial logistical hub directly supplies Ukrainian forces in the area, and is a major node in this part of the frontline. As long as Ukrainians hold Siversk, the entire Russian front remains unstable, with Ukrainian forces able to launch counterattacks and disrupt Russian supply routes.

After multiple failed assaults in the region, Russian forces changed tactics, launching 3 simultaneous attack vectors in an attempt to overwhelm Ukrainian defenses. To find a weak spot, they launched a large-scale mechanized assault on Verkhnokamianske, the last Ukrainian-held village standing between them and Siversk.

The first Russian assault wave consisted of infantry units sent into clear preliminary Ukrainian position,s and safeguard the flanks of the main assault. If we look at the topographic map, we can see that their aim was the Ukrainian defensive structures, located on the hill above the roads leading to the village.

The Russian objective was to take control of them and prevent Ukrainian counterattacks from the north, allowing the heavier mechanized assault teams to advance without immediate interference.

Geolocated footage shows Russian soldiers hiding in a ditch, attempting to toss explosives into a Ukrainian bunker. However, the Ukrainian defenders react quickly, throwing the explosives back out before they can detonate inside.

The explosion kills and wounds multiple Russian soldiers, forcing the rest to retreat, and exposing the vulnerability of their assault strategy. Instead of clearing out Ukrainian positions, the first vector stalled under heavy Ukrainian fire.

With infantry failing to clear the outposts, the Russians decided to rely on heavily armored “turtle tanks”, covered in makeshift metal plating to resist Ukrainian anti-tank weapons. These modified vehicles, equipped with mine rollers, were meant to breach Ukrainian defensive lines and punch through toward the village outskirts.

However, despite their armor, Ukrainian FPV drone operators systematically targeted the weaker sections of these vehicles, time and time again, hitting engine compartments and exposing crew positions, until they were immobilized and caught fire.

As the first turtle tank exploded in a massive fireball, Russian infantry disembarked and ran for cover, but was left entirely exposed and easy prey for the Ukrainian drone operators. Russians started being hunted down by swarms of kamikaze drones and drone-dropped grenades, effectively eliminating dozens of Russian troops before they could reach Ukrainian trenches.

Despite failing to secure the hills or breach Ukrainian lines in the first 2 assaults, Russian forces launched a 3rd attack with another wave of armored vehicles. Likely believing the Ukrainian defenders were exhausted, they hoped this final push would finally break through.

The 1st vehicle in this group was again a turtle tank, which, unfortunately for the Russians, hit a Ukrainian anti-tank mine and got immobilized on its left side during the attack, which made him an easy target for the Ukrainian drone operators. Soon, several kamikaze drones hit him one after another, and the crew was forced to run in the open.

From that moment, the hunt was on. Despite the Russians trying their best to escape from the drones, with some of them even praying or throwing their weapons, as a last attempt to avoid the inevitable, the skillful Ukrainian operators from the K-2 battalion found and eliminated every one of them.

Overall, despite attempting a coordinated assault on multiple vectors, using infantry clearing teams and armored vehicles, the Russians failed to breach Ukrainian defenses towards Siversk. While each attack vector was designed to mutually support the others, Ukrainian forces effectively neutralized each one, ensuring that Russians could not achieve a breakthrough.

By maintaining control of Verkhnokamianske, Ukrainians have once again halted the Russian advance, keeping Siversk and the frontline stable, while prompting enemy forces into another disastrous assault.


11,893 posted on 02/14/2025 2:59:46 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11890 | View Replies]

To: AdmSmith
"Eggs
In Tyumen, the minimum cost of a dozen chicken eggs rose to 81 rubles in January."

In Moscow, eggs average $1.72 in US dollars.

Russian wages average about 23% of US wages, so $1.35 in Moscow is the equivalent of around $7.48 in the US.
$7.48 is about what I'd pay at Giant Food in eastern PA, Walmart's best prices are around $5.46.
Russian egg prices, both domestically produced and imported have increased due to several factors, including declining ruble values, labor shortages and bird flu.

US egg prices have also risen substantially since bird flu struck in early 2022 -- increasing from ~$2.00 per dozen to now average $4.95 per dozen, nationwide.
The US range of prices is around $4.25 (Nebraska) to over $7 (i.e. Chicago).

Some progress has been made against bird flu, but US egg prices are not expected to return to normal in 2025.

11,894 posted on 02/14/2025 3:31:52 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11839 | View Replies]

To: Forward the Light Brigade; PIF; FtrPilot

1854 Battle of Balaclava, 40% casualties:

Forward the Light Brigade: "Nope—No USA and there is no EU or NATO.
Cut all funds from Europe—pull back our vacationing service men from the bases in Germany and UK.
WW II was long ago."

In WWII, Russia and the US were allies!
So, yes, that was very long ago.

NATO was founded post-WWII, 1949, specifically to defend Europe against aggressive Russian empire building in eastern Europe.

For 76 years, NATO's strength & unity has prevented another major war in Europe.
Russian invasions of countries like Afghanistan, Moldova, Tajikistan, Chechnya, Dagestan, Georgia, Syria, CAR, Mali and Ukraine are in, precisely, areas where NATO was weak, or non-existent.

Russia's aggressions against Ukraine prove, yet again, what happens when Western allies look weak, stupid and/or corrupt in the eyes of expansionist dictators like Vlad the Invader.


11,895 posted on 02/14/2025 4:10:12 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11844 | View Replies]

To: PIF; BeauBo; blitz128
🍈 "Soon to be the United States of Europe"

The European Union is a United States of Europe:


11,896 posted on 02/14/2025 4:20:31 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11848 | View Replies]

To: BroJoeK

Rush used to have a thing he called the gorbasums, 🍈 is defiantly at that stage..
The MRLS of memes😂


11,897 posted on 02/14/2025 4:52:19 AM PST by blitz128
[ Post Reply | Private Reply | To 11891 | View Replies]

To: BroJoeK

I would add that egg prices in Russia have nothing to do with culling of egg laying population. Our problem can be fixed, started on Jan 20, Russians can not and will only get worse


11,898 posted on 02/14/2025 4:55:09 AM PST by blitz128
[ Post Reply | Private Reply | To 11894 | View Replies]

To: AdmSmith

“Ethnic groups”. You mean White Russians.
Ethnic Russians have been exploiting all others of the “federation” for decades.
Which is why Moscow and St. Petersburg are showcases, and much of the rest of Russia and the federation are living in the 1900s


11,899 posted on 02/14/2025 5:00:00 AM PST by blitz128
[ Post Reply | Private Reply | To 11889 | View Replies]

To: AdmSmith

“ IISS noted that Russia has adapted some of its tactics to address ongoing equipment shortages and is increasingly relying on infantry-led assaults to advance along the frontline”

Adaption or forced regression ?

They would if they could, they don’t because they cant.

The Soviet legacy equipment storages are depleted, the t-14, su-57s are MIA, and the t-90 amd bmp-3, are just rolling hulks just waiting to be blown up.

Their much vaunted AD, can’t protect their infrastructure.

They now rely on NK, China, and Iran to sustain not only war effort, but basic economy.

Ladas, motorcycles, atvs, mules, and camels are their “break through”‘weapons of necessity now.

Trumps going to send them a lifeline, don’t think so


11,900 posted on 02/14/2025 5:11:29 AM PST by blitz128
[ Post Reply | Private Reply | To 11887 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,861-11,88011,881-11,90011,901-11,920 ... 19,261-19,263 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson