Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,601-11,62011,621-11,64011,641-11,660 ... 19,481-19,499 next last
To: JonPreston

Bannon at Harvard

https://rumble.com/v3by09g-warroom-live.html


11,621 posted on 02/09/2025 6:26:48 PM PST by combat_boots
[ Post Reply | Private Reply | To 11620 | View Replies]

To: blitz128

Love it 🍈
Maybe the Russians can use your nuclear memes in Kursk, perhaps launched from a mule mlrs, heard they are out of ladas 😂


11,622 posted on 02/09/2025 6:28:41 PM PST by blitz128
[ Post Reply | Private Reply | To 11619 | View Replies]

To: combat_boots

Thanks. Bannon is a Harvard grad, and a Class A MAGA star.


11,623 posted on 02/09/2025 6:30:13 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11621 | View Replies]

To: blitz128
Love it 🍈


11,624 posted on 02/09/2025 6:32:10 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11622 | View Replies]

To: blitz128

Word of the day
🍈


11,625 posted on 02/09/2025 6:33:52 PM PST by blitz128
[ Post Reply | Private Reply | To 11622 | View Replies]

To: blitz128
Word of the day 🍈


11,626 posted on 02/09/2025 6:34:55 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11625 | View Replies]

To: blitz128

😂🍈🦆


11,627 posted on 02/09/2025 6:37:03 PM PST by blitz128
[ Post Reply | Private Reply | To 11625 | View Replies]

To: blitz128
😂🍈🦆


11,628 posted on 02/09/2025 6:38:12 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11627 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 9, 2025

Russia continues to leverage its partnerships with US adversaries, including North Korea, to offset the resource shortages constraining Russia's economy and war effort. South Korea's Yonhap News Agency reported on February 9, citing South Korea's National Intelligence Service (NIS), that thousands of North Korean workers arrived in Russia in 2024 to take construction jobs.[1] Russian official data shows that 13,221 North Koreans entered Russia in 2024 — up to 12 times the number that entered Russia in 2023. Many of the North Korean workers are reportedly entering Russia on student visas, with 7,887 North Koreans having entered Russia in 2024 for alleged education purposes. Russian opposition outlet Vazhnye Istorii reported on February 4 that the number of North Koreans who came to Russia to study in 2024 was the highest number since 2019.[2] Russian opposition outlet Mediazona reported in November 2024 that data from the Federal Security Service (FSB) Border Service showed that a record number of North Koreans entered Russia for education between July and September 2024 — notably in the lead up to the reported start of North Korea's deployment of troops to Russia in early October 2024.[3]

Russia has been suffering from significant labor shortages in both its civilian and defense industrial sectors since the start of its full-scale invasion of Ukraine.[4] The arrival of several thousands of North Koreans to work in civilian sectors is marginal and will not significantly alleviate Russia's labor shortages. Russia reportedly has an estimated labor shortage of 1.5 million workers as of December 2024, for example.[5] North Korea's provisions of materiel and troops to Russia have significantly increased over the course of 2024, however, and the several thousands of North Korean workers that arrived in Russia recently may be the beginning of larger influxes in the future that could more significantly help Russia's labor shortage issues. (Russian forces‘ initial use of small numbers of North Korean artillery and mortar shells grew rapidly, with 60 percent of Russian forces‘ artillery ammunition fired now being sourced from North Korea as of December 2024.[6]) Russian enterprises are also likely not paying North Korean workers the same salaries as Russian citizens, so a significant influx of North Korean workers into the Russian work force in the future could also financially benefit Russian enterprises that are having to offer high salaries to Russian citizens in order to compete against Russian military and defense industrial enterprises for employees. Significant increases in the number of North Koreans working in Russia's civilian sectors in the future could also free up Russian civilian sector employees to work in the Russian defense industrial base (DIB) or fight in Ukraine.

The arrival of North Korean workers to Russia demonstrates how Russia, a permanent member of the United Nations Security Council (UNSC), is violating UNSC Resolution 2397. Russia voted for Resolution 2397 in 2017 in response to North Korea's intercontinental ballistic missile (ICBM) tests.[7] The resolution explicitly prohibits North Korea from sending its citizens abroad for work and mandated that all UN member states expel all North Koreans “earning income” abroad by December 2019. Russia is likely using the guise of student visas to hide Russia's violation of the resolution.

North Korean dictator Kim Jong Un continues to reiterate his support for Russia and its war effort in Ukraine. Kim gave a speech at the North Korean Ministry of National Defense on February 9 that heavily focused on the threats the US and the West allegedly pose to North Korean security.[8] Kim criticized the US for protracting the war in Ukraine and claimed that he is “seriously concerned” about the West's alleged desire to inflict a strategic defeat on Russia. Kim notably claimed that the North Korean military and people will “invariably support and encourage” Russia's “just cause” to defend its sovereignty, security, and territorial integrity “in the spirit of” the June 2024 Russian-North Korean comprehensive strategic partnership agreement.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-9-2025

11,629 posted on 02/09/2025 11:50:24 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11568 | View Replies]

1,170 i.e. more than 48 Russians and Norks/h. In total > 850,000 and more than 10,000 tanks. Vehicles and fuel tanks more than 200% and artillery more than 50% above the average. (Typo: planes should be 370 +0)


11,630 posted on 02/10/2025 12:32:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11569 | View Replies]

To: AdmSmith; SpeedyInTexas

10,000 tanks!

Even though this (Ukrainian) source includes Infantry Fighting Vehicles (BMP, in Russian), as well as Main Battle Tanks in this category for their count; this still represents the scrapping of the world’s largest Armored force.

The Super Bowl of demilitarization.


11,631 posted on 02/10/2025 1:36:37 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 11630 | View Replies]

To: BeauBo

The 10,000 might be real tanks as https://www.quora.com/Why-is-the-BMP-1-classified-as-an-AFV-and-APC-and-not-a-tank


11,632 posted on 02/10/2025 3:14:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11631 | View Replies]

To: AdmSmith

Birds of a feather flock together as the saying goes

Just another example of how Russia’s claims of self sufficiency ring hollow, and Putin’s ego is destroying Russia.
As I have said before this war has become an existential threat, not to Russia though it will suffer, but to putin.

America has had its eyes opened to the greed and corruption that was destroying it economically and morally , Russia has not quite reached that point, but it is close.


11,633 posted on 02/10/2025 3:47:00 AM PST by blitz128
[ Post Reply | Private Reply | To 11629 | View Replies]

To: AdmSmith

In a bold move that surprised everyone - even the Chinese - North Korea has taken over Russia. Xi Jinping stunned.


11,634 posted on 02/10/2025 4:13:33 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11629 | View Replies]

To: BeauBo

10,000 tanks!


Shortly to include North Korean tanks and artillery systems.


11,635 posted on 02/10/2025 4:15:21 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11631 | View Replies]

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Putin in Shock! Ukrainians Breach Russian Lines Again! ]

Today [ Feb 09, 8 pm ], there is a lot of big news coming from the Kursk direction.

Here, Ukrainians are overrunning Russian soldiers as they launched a massive surprise assault in the Kursk salient.

Catching Russian forces completely off guard, the Ukrainians achieved a massive breakthrough through a coordinated mechanized assault, penetrating over 4 kilometers deep into Russian lines.

After Russians suffered heavy losses in their recent failed attacks on the Ukrainian salient, Ukrainians decided to press their advantage and take Russian forces by complete surprise in a sudden assault southeast of Sudzha.

Ukrainians started by covertly accumulating their forces in Sudzha, planning to use the hardened roads leading out of the settlement for a lightning assault through Russian lines, near Cherkasskoya Konopelka.

Ukrainians initiated the operation with an intense artillery barrage to suppress Russian positions on the frontline, while FPV kamikaze drones precisely eliminated dangerous Russian firing positions, along the planned avenue of attack. Shortly after the last shells landed, Ukrainians initiated their first ground assault with a massive mechanized column, overrunning Russian positions and advancing along the key hardened roads.

With the preliminary Russian positions taken out of the equation by Ukrainian shelling and drone strikes, Ukrainian forces quickly reached Cherkasskaya Konopelka and Fanaseevka, dismounting their infantry in the settlements and surrounding forest.

After establishing their positions, the southern flank was secured, allowing Ukrainians to launch another 3 waves of mechanized forces to reinforce these positions, and advance further toward Ulanok, starting intense clashes with the Russian garrison in the settlement. Russian sources reported that Ukrainians used nearly a full mechanized battalion during their assaults, with up to 400 soldiers and 30 to 50 various armored vehicles.

Footage from the area shows how Russians quickly scrambled to counter the threat, trying to eliminate the leading Ukrainian mine-clearing vehicles. However, Ukrainian electronic warfare equipment did not allow Russians to launch swarms of drones to counter the Ukrainian advance.

This limited the Russian forces to only use a scarce number of fiber optic FPV drones, which which are immune to electronic warfare, as they do not require any radio signals to be controlled, however their low numbers caused only minimal casualties to the Ukrainian assault group.

Additional footage from Chechen Akhmat special forces shows how Russians had not prepared any defensive positions, like foxholes or trenches in this area, forcing them to lay prone in the forest, while Ukrainian kamikaze drones conducted precision strikes on their forces. Further footage from Russian fiber optic reconnaissance drones shows a Ukrainian MRAP landing an assault group in the forest near Ulanok, ready to take over control of the town.

The main goal of the Ukrainian counterattacks was to take the settlement of Ulanok, and increase the buffer zone between Sudzha and Russian frontline positions. Sudzha is the most crucial town in the Ukrainain salient in Kursk, where all their logistics and reinforcements flow through.

With Russians having shown to be incapable of rapid advances or maneuver warfare against prepared Ukrainain defenses, Ukrainians are trying to force the Russians to conduct costly week-long grinding battles, in an effort to retake the ground that the Ukrainians had taken in just a single day.

By advancing to the Psel River in the south, Ukrainians are also attempting to cut off the Russian forces to the south of Sudzha from direct reinforcements. Any further advance in this area would also allow Ukrainians to establish a robust line of defense along the Psel River while concentrating their fire on the open fields and forests to the east.

Overall, Ukrainian forces successfully overwhelmed preliminary Russian positions south of Makhnovka and exploited this success to achieve a 4.5 kilometer-deep breakthrough south of Sudhza. With Ukrainians successfully landing and consolidating their newly gained positions, the remaining Russian forces south of Sudzha were effectively cut off from their ground lines of communication, forcing further reinforcements to cross the Psel River in rubber boats.

Most importantly, Ukrainians have once again demonstrated their ability to reintroduce maneuver warfare under the correct circumstances and make significant gains in one day that will take the Russians weeks of costly grinding battles to retake.

With the Russian failure to contain the Ukrainian advance, the Russian high command has decided to immediately dismiss the commander of the 11th VDV Airborne Brigade, Pavel Filyatev, for failure to properly defend his area of responsibility.


11,636 posted on 02/10/2025 4:24:56 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11635 | View Replies]

To: PIF
Ukrainian drones struck the Afipsky oil refinery in Krasnodar Krai overnight. "Debris" from a downed drone also hit a residential building. Russia's MoD claims 15 drones were shot down over its territory.

https://x.com/NOELreports/status/1888863464233291808


11,637 posted on 02/10/2025 5:16:20 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11634 | View Replies]

To: PIF
🇺🇦 The 66th Mechanized Brigade wipes out a group of Russian forces, an AGS-40 grenade launcher, a "Klen" radar, and a Starlink system on the Lyman front.

https://x.com/NOELreports/status/1888879545580769318


11,638 posted on 02/10/2025 5:24:03 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11637 | View Replies]

To: AdmSmith
Ukraine's Air Force reporst on another large-scale Shahed drone attack overnight. Out of 83 launched, 61 were shot down and another 22 (of which some were drone simulators/dummy's) were supressed by electronic warfare.

https://x.com/NOELreports/status/1888863157084389652

83 out of 83.

Once again, no reported cruise missiles.

11,639 posted on 02/10/2025 5:33:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11638 | View Replies]

To: All
Ukrainian forces successfully hit the Afipsky refinery in Krasnodar, located near Russia's 90th Anti-Aircraft Brigade. Despite the proximity of advanced Buk-M3 systems, Russian air defenses failed to prevent the strike.

https://x.com/NOELreports/status/1888933511932899804


11,640 posted on 02/10/2025 5:47:39 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11639 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,601-11,62011,621-11,64011,641-11,660 ... 19,481-19,499 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson