Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: SunkenCiv

Related
800-year-old graves pinpoint where the Black Death began Ancient DNA from cemeteries in today’s Kyrgyzstan reveal earliest known victims of 14th century plague.

The Syriac engraving on the medieval tombstone was tantalizing: “This is the tomb of the believer Sanmaq. [He] died of pestilence.” Sanmaq, who was buried in 1338 near Lake Issyk Kul in what is now northern Kyrgyzstan, was one of many victims of the unnamed plague. By scrutinizing field notes and more photos from the Russian team that had excavated the graves in the 1880s, historian Philip Slavin found that at least 118 people from Sanmaq’s Central Asian trading community died in the epidemic.
https://www.science.org/content/article/800-year-old-graves-pinpoint-where-black-death-began


5 posted on 09/08/2025 7:32:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies ]


To: AdmSmith

It was more than just that they found the earliest known, the virus itself was a parent form that hadn’t mutated, pristine. So it’s pretty much a smoking gun that those Kygrsystanfijdfls were the first effected. I guess since it ended up hittting everyone else eventually anyway they got off easy dying before before all the economic and social disasters hit.


13 posted on 09/08/2025 8:27:36 AM PDT by pepsi_junkie ("We want no Gestapo or Secret Police. F. B. I. is tending in that direction." - Harry S Truman)
[ Post Reply | Private Reply | To 5 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson