Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

The Babylonian Map of the World with Irving Finkel [17:59]
YouTube ^ | Premiered August 1, 2024 | Irving Finkel, The British Museum

Posted on 08/03/2024 11:40:19 AM PDT by SunkenCiv

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-4041-52 next last
Transcript
·Intro
0:00·In The British Museum, we have objects of all sizes.
0:03·Some pinheads, and some gigantic, and everything in between.
0:06·And once in a while, one of the very smallest things
0:10·turns out to have information in it
0:13·which is totally unexpected.
0:15·My name is Irving Finkel
0:16·and I'm a curator in The British Museum in the Middle East Department
0:19·and welcome to my corner.
0:27·Curator's Corner with Irving Finkel So what we have here
0:29·is a clay tablet.
0:30·As a matter of fact, it is not a real clay tablet
0:34·it is a replica
0:35·because the real clay tablet has to be on exhibition all the time
0:39·and also it's very delicate
0:40·we couldn't wave it around in front of the screen
0:42·and say "look at this, look at that"
0:44·that would be terribly irresponsible.
0:46·So but we can use this
0:47·replica
0:48·for demonstration purposes with impunity.
0:51·The ancient Mesopotamians
·Ancient Mesopotamian Cuneiform Tablets
0:53·Sumerians, Babylonians, all those people
0:55·they wrote on clay, that was their natural activity
0:59·and clay tablets which have impressions of writing on
1:02·are pretty good, they're pretty stable
1:04·you can handle them
1:04·you can't play football with them
1:06·but they're pretty reliable
1:08·but what happens in antiquity
1:10·is there are wars, and buildings collapse
1:12·and fires, and disasters
1:13·and people die and they go away
1:15·and other people come and trample on things
1:17·and when archaeologists find them
1:19·it is not often that an ancient inscription on a piece of clay
1:24·comes to light in perfect condition.
1:26·So this tablet
1:28·you can easily see that it isn't complete
1:30·there's stuff missing here there's stuff missing there
1:33·and it also looks like elephants
1:35·have danced a polka over the surface
1:37·because many of the signs are damaged or squashed
1:42·But nevertheless, this piece of cuneiform inscription
1:46·is a remarkable thing.
·The oldest map of the world, in the world
1:48·This is the oldest map of the world!
1:52·...in the world.
1:53·It has two sides, this is the front or 'obverse'
1:56·and this is the back or the 'reverse'
1:58·and the reverse consists of lots of lines of cuneiform
2:02·in different ruled sections.
2:04·So it's full of information, even though it's a bit damaged.
·What is the Babylonian Map of the World?
2:08·But the other side is the remarkable thing.
2:10·Firstly there's some lines of cuneiform
2:13·ruled across very firmly at the top
2:15·and this is about the early creation of the world
2:18·and how animals were put in the sea and in different parts of the universe
2:21·it's a kind of brief summary of creation
2:25·which has nothing to do with the map
2:26·because there's a clear border between that and this
2:30·and it's this which is so exciting
2:32·because if you look carefully you will see that the flat surface of the clay
·The Babylonian Map of the World explained
2:36·has a double circle drawn in the surface of the clay.
2:39·Now the double ring is very important
2:42·because it has cuneiform writing in it
2:44·which says it's the "Bitter River"
2:47·and this water was deemed to surround the known world
2:52·because the area inside the double ring...
2:55·is Ancient Mesopotamia itself.
2:59·Now this word 'Mesopotamia' is the Ancient Greek word
3:02·for what is modern Iraq.
3:06·So inside the drawing of this circle
3:08·we have very interesting things.
3:10·There is a great river that runs from north to south
3:14·which is the Euphrates river.
3:17·and the river is straddled
3:19·by a long oblong which is obviously
3:23·the city of Babylon.
3:24·So this is a very important ring of water
3:27·because it meant for the Babylonians, they had a sort of idea
3:30·of the limits of their world where they lived
3:33·in about the 6th century BC
3:35·with these important rivers which brough life and food to them
3:39·waterways for transport
3:41·all the way down to the Persian Gulf it was kind of depicted in small
3:46·and if you look carefully at the picture you will see
3:48·that in the surface of the known world there are these rings drawn
3:53·with little bits of cuneiform inside those
3:56·and those tell you the name of the city which it represents or sometimes the tribe.
4:02·So you have, encapsulated in this circular diagram
4:06·the whole of the known world in which people lived, flourished and died.
·What are the triangles on the Babylonian Map of the World?
4:13·However...
4:14·there's more to this map than that
4:16·because if you look at the outer ring
4:19·you will see that going off at different angles are triangles
4:23·sometimes people say they are islands
4:26·sometimes people say they are districts
4:28·but in point of fact they are almost certainly mountains
4:32·because the idea is that if you go across the water
4:35·you see these jutted, pointed things, above the horizon
4:40·which are remote lands far beyond the limits of the known world
4:45·which go out in different directions from the perimeter of existence
4:50·and they are, for the Babylonians... places full of magic, and full of mystery.
4:56·Now when you look at the diagram, sort of geometrically
5:00·it is evident there were originally eight of them.
5:04·And we can be sure of this, partly by calculation of what makes sense
5:08·and also, on the other side, the inscription which I showed you before
5:14·tells you what is on each of those triangles.
5:18·There was a place where the sun was never seen
5:21·there was a tree that had jewels instead of fruit
5:26·and there were giant birds that couldn't fly
5:28·all those sorts of things
5:30·there were traditional stories associated with each of these districts
5:35·recorded together with the diagram to show where they were.
5:39·Well, of course probably nobody ever went there
5:41·we're talking about the imaginative world
5:44·of cosmology, of theology, of tradition, of inherited ideas...
5:50·But the thing is this
5:52·up until quite recently, we didn't know which description on one side
5:57·went with which triangle on the front.
6:01·And this is an irksome matter because we know there's supposed to be eight
6:05·but there was nowhere near eight on there
6:07·so we had to work out which place
6:09·the three which we could read clearly matched up with the descriptions on the back
6:14·and it wasn't really possible.
6:15·And then something happened
·Missing triangle on the Babylonian Map of the World
6:17·one of those missing triangles
6:19·came to light in the collection.
6:24·Now, in the 19th century
6:26·when tablets were excavated
6:28·they were very careful to bring back everything.
6:31·So, a big lump of clay
6:33·any small bits lying around it
6:35·any small bits not lying around it
6:37·anything they could find with writing on was carefully, carefully excavated.
6:42·And sometimes the very small pieces
6:44·which we couldn't join to anything were put in special trays
6:47·for the long-term future when it might be possible to see what we could do about them.
·Edith Horsley - Cuneiform LEGEND
6:52·Now what happened, was this...
6:54·Once upon a time...
6:56·There was a lady called Edith Horsley.
7:00·And Edith Horsley loved cuneiform stuff
7:03·and she came to classes that I used to teach after work
7:07·once a week to learn about cuneiform
7:09·and she was very very enthusiastic about it
7:11·and very attentive, and a good student.
7:13·And when the class came to an end after several months
7:16·she said she wanted to do something more...
·Channel 4 News report on Babylonian Map of the World September 1995
7:20·For as long as anyone can remember, this has been a map with a central piece missing
7:24·but from today, no longer.
7:26·Nicholas Glass reports on an unexpected moment of archaeological excitement in The British Museum.
7:31·The British Museum has boxes of tablet fragments, but it's only in the last two months or so
7:37·when Edith Horsley was first invited to work at the museum
7:40·that they began trying to sort things out.
7:43·Well even as a child I was intrigued by the signs that are used in cuneiform.
7:49·but it wasn't until I attended Irving Finkel's lectures that I became an addict.
7:56·As a volunteer, Edith comes in just once a week
7:59·she was asked to keep an eye out for any piece with a geographical or astronomical image on it.
8:05·I saw this quite small piece with this triangle on it,
8:11·and the signs inside
8:12·and I thought it was probably a map.
8:17·So I put it in the little section where I put the pieces that I think are of special interest
8:22·'cause Dr. Finkel can't go through all of these trays obviously.
8:27·So I put those aside and he became quite excited when he saw it.
·BABY IRVING!
8:32·She put aside a little pile of half a dozen pieces that didn't look like everything else
8:36·and I went through them one by one
8:37·and she said "look, this one's got some lines on it"
8:40·and as soon as I saw it I knew it must belong to this tablet
8:43·because as I say, it's such an unusual thing.
8:46·It's actually rather funny because the map wasn't in
8:48·its normal place it was downstairs on exhibition
8:51·and so I got out an old photograph of it
8:53·and the photograph was at a different scale
8:56·so when I put the fragment on the photograph I was sure that it must
8:58·belong but I couldn't quite see where it would fit
9:00·and it was only the following morning that I
9:02·took the fragment downstairs to the exhibition where it's on public view
9:06·and by looking at the original tablet I
9:08·could see straight away that it fitted perfectly in the hole.
9:11·And it did.
9:11·And as a matter of fact, when I put it in experimentally in the gallery in front of Edith
9:17·we couldn't get it out again afterwards, it was such a snug fit
9:20·and it had to go down to conservation to be dealt with properly and glued in position.
9:25·So, having opened a bottle of bubbly and danced around in the gallery
9:29·the time came to think very seriously about what this meant.
9:33·Because the tablet is very famous
9:35·it's often reproduced in all sorts of different encyclopedias
9:38·and books about ancient ideas, and histories of maps of course
9:42·and it's quite a famous object, and to make a join to that was an extraordinary thing.
9:47·But then there was the question of what did it tell us...
·What the missing piece revealed
9:51·Against one of the diagonals, there was in cuneiform, the expression "The Great Wall"
9:59·I'm going to read you what the scribe tells us about this triangle.
10:04·"To the fifth, to which you must travel seven leagues"
10:08·that means you have to row across the bitter river
10:12·for seven leagues before you can land at the foot of the mountain
10:16·"The Great Wall, its height is 840 cubits
10:23·its trees up to 120 cubits.
10:27·by day you can't see in front of yourself, by night, lying on . . ."
10:32·it's still broken
10:33·"then you must go another seven leagues in the sand and you must. . ."
10:37·There's always dot dot dots, because nothing is perfectly preserved
10:41·but the important thing is, we now know which of the triangles
10:45·goes with the description of this gigantic wall.
10:49·As a result of Edith's discovery, we've got three of these triangles in a row
10:55·and that is a great boon, because you can imagine
10:58·if you have isolated triangles, trying to match them to the description on the back
11:02·it's very difficult to get anywhere seriously and reliably.
11:06·But when you've got three in a row
11:08·all you have to do is find three descriptions in a row and it stands to reason
11:12·that you'll be able to somehow match them up
11:14·and that is what we did.
11:16·And the discovery was very clear once you realised
11:20·that the counting was anti-clockwise, and not clockwise.
11:25·So, number four says "To the fourth, to which you must travel seven leagues"
11:29·because it's like a kind of fairytale, everybody knows it's always the same introduction
11:34·so each time you have to travel seven leagues across the water.
11:38·Then it gets a bit broken,
·The ark and parsiktu-vessel
11:39·then it says you see something which "are as thick as a parsiktu-vessel"
11:47·This parsiktu measurement, is something to an Assyriologist which makes their ears prick
11:53·and the fact is it's only once otherwise known from cuneiform tablets
12:01·and it's rather an interesting cuneiform tablet too.
12:05·Because it is the description of the Ark
12:08·which was built, theoretically, in about 1800BC
12:13·by the Babylonian version of Noah
12:16·and in this account, the details are given
12:19·and the God says "you have to do this, this and this"
12:22·and then the Babylonian Noah says "I did this,
12:24·this and this. I've done it! And I made these structures as thick parsiktu vessel"
12:30·he says out of his own mouth, in the original story.
12:33·So this word 'parsiktu' is like a kind of
12:39·[RINGING NOISE] noise
12:40·it immediately locks into this thing on the map.
12:44·Immediately, and incontrovertibly.
12:46·So what it means, speaking plainly here
12:49·if I may speak plainly here
12:51·is that if you went up this mountain all the way
12:54·with your sandwiches, and breaking regularly for
12:57·[INHALES]
12:57·lungfuls of fresh air
12:59·eventually you would see against the night sky, or the dark sky of the outer universe
13:04·silhouetted, the ribs, the ribs made of wood
13:08·as thick as a parsiktu vessel
13:11·of the wreck of the Babylonian Ark
13:14·which, like the one in the Bible, came to rest on a mountain.
13:18·And if you come down the mountain, and cross over the water back to the homeland
·Mount Ararat and Mount Urartu
13:23·the first place you come to is called 'Urartu', it's drawn on the map.
13:27·Now, the interesting thing about that is that in the Bible
13:31·Noah, in his Ark, landed on a mountain where the name is 'Ararat'
13:36·and 'Ararat' is the Hebrew equivalent of the Assyrian 'Urartu'.
13:43·That's quite a meaty thing, quite an interesting thing to think about.
13:47·Because it shows that the story was the same, and of course that one lead to the other
13:51·but also, that from the Babylonian point of view, this was a matter of fact thing.
13:56·That if you did go on this journey
13:58·you would see the remnants of this historic boat
14:02·which saved all the life of the world for the long-term future,
14:05·from which we of course profit today
14:08·still there, in the crags, against the dark sky.
·What does it all mean?
14:19·So what does this actually mean to us?
14:21·Well, lets imagine that we can borrow a time machine and go back to Ancient Mesopotamia
14:25·I've always thought this was a good idea, we'll have a party, we'll all go together.
14:29·And when we get there somebody might say "Any idea where the Ark is?"
14:32·and I'll go "We have the map! Here it is! and in fact it's THERE! That's where it is."
14:38·And what we have to do is get in our rowing boat, off we go
14:40·and we will see it for ourselves.
14:40·So although it is a map which would not encourage you perhaps
14:40·And what we have to do is get in our rowing boat, off we go, and we will see it for ourselves.
14:44·So although this is a map which would not encourage you perhaps
14:47·to moat across Iraq today in a land rover
14:50·when it comes to operating beyond the limits of the known world,
14:54·into the world of imagination, it's indispensable.
14:58·So, for the first time we can pronounce with authority, that if we were an ancient
15:02·Babylonian we would know where to go to see the remains of that wonderful boat.
·Author of Babylonian Map of the World
15:07·But then there's the actual question of who wove it together?
15:11·Well it's often the case with cuneiform tablets that at the bottom of the reverse
15:16·there's a bit that tells you the name of the scribe, what's called the colophon.
15:21·And unfortunately, the scribe's name is broken. There's no trace of it left.
15:29·But, his father's name is there. Because in Babylonia, they always said, "Mr. So-and-So, son
15:36·of Mr. So-and-So." And the dad was called Iṣṣuru. Now ‘Iṣṣuru' is the Babylonian word for ‘bird'.
15:47·Now this is rather an interesting thing, because we know all about peoples names in Mesopotamia.
15:52·They usually meant something intelligible like ‘Servant of Such and Such a God',
15:55·or ‘She's Beautiful Beyond Compare' – no one is called
15:59·Bird. There's no other case of a person called Bird, it's not a very good name!
16:04·So what does that mean?
16:06·You look at this for the first time in the museum case, which I hope you will now do,
16:10·and peer through and make out the details, you would think “Ah! I see,
16:15·it's a sort of birds-eye view of the world!” Well I think that's what it is. It's a Birdy
16:22·Birdy family, and this is a birds-eye view of the known world and what lies beyond it.
16:29·So that gives it a special kind of warmth of understanding. Because it's failings as
16:35·it were from a cartographical point of view are irrelevant,
16:39·it is not what they're interested in.
16:41·And it's given us a tremendous insight into many aspects of Mesopotamian thinking,
16:46·it's also a triumphant demonstration of what happens when you have a very small
16:51·totally uninformative and useless fragment of dead boring writing that no one can
16:57·understand and you join it onto something in the collection which is much bigger
17:01·and a whole new adventure begins all over again!
17:07·Hey you! Cuneiform nerd! Do you want some more cuneiform? Of course you do. Below is a playlist
17:12·full of all the videos we've ever made concerning cuneiform, and you can see in the top left
17:17·corner right now a preview of the next episode of Curator's Corner, which also covers cuneiform.
17:23·We are going to the ancient Sumerian city of Girsu in southern Iraq, where Sebastien Rey will
17:28·talk you through two bricks that were found in the same building. That's pretty normal,
17:33·buildings are made of bricks. The weird thing is, is that these bricks were made
17:37·1500 years apart from each other, but were in the same building. Also, crazy thing,
17:43·Sebastien's excavated both of these bricks, but one of those bricks has
17:47·been excavated twice previously. And the first time it was excavated was 2300 years ago!
17:54·Archaeology is weird.

1 posted on 08/03/2024 11:40:19 AM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...
As always, I have no interest in complaints about the YouTube-generated transcript.
The rest of the Irving Finkel keyword, sorted:

2 posted on 08/03/2024 11:41:57 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

What’s the Babylon Bee’s map of the world? I can only imagine.


3 posted on 08/03/2024 11:44:53 AM PDT by DannyTN
[ Post Reply | Private Reply | To 2 | View Replies]

To: SunkenCiv

How long did it take you to post all this stuff?


4 posted on 08/03/2024 12:01:31 PM PDT by Jim W N (MAGA by restoring the Gospel of the Grace of Christ (Jude 3) and our Free Constitutional Republic!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Irving is a treasure!


5 posted on 08/03/2024 12:07:10 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv
Love Irving Finkel.

I can format that transcript for you with punctuation, paragraphs, caps, etc. in about 2 seconds by asking ChatGPT. Would you like?

6 posted on 08/03/2024 12:11:05 PM PDT by RoosterRedux (“Thinking is difficult, that’s why people prefer to judge”, wrote Carl Gustav Jung.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Wow! Glad there are scholars who can figure these things out. Wish I had that kind of academic fortitude.


7 posted on 08/03/2024 12:15:25 PM PDT by Fester Chugabrew (In a world of parrots and lemmings, be a watchdog.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: SunkenCiv

That tablet looks indecipherable.


8 posted on 08/03/2024 12:22:10 PM PDT by ComputerGuy (Heavily-medicated for your protection)
[ Post Reply | Private Reply | To 2 | View Replies]

To: All

with all due respect to dr. finkel, his translation is wrong. in fact, the actual translation is as follows:

...I...

...hate...

...snakes...

:-O


9 posted on 08/03/2024 12:36:37 PM PDT by SteveH
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Kewl!!!

(Although you might say we got flipped the Bird near the end...)


10 posted on 08/03/2024 12:38:52 PM PDT by null and void (I identify as a conspiracy theorist. My personal pronouns are told/you/so.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: null and void

Everybody knows about the bird.


11 posted on 08/03/2024 12:44:34 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Jim W N

I used the YT transcript to feed a little doodad that puts it into a table format, I used the keyword source code to feed another little doodad, which feeds a sorter doodad, and I’ve got a standard YouTube vid template which is easily used.

If you go to any of the Musical Interlude topics, there’s an ezpost link (4 different ways) that generates a post for the topic with the template all loaded. All that’s needed is the text you see above and the eleven digit number of the vid itself. :^)

So, maybe ten minutes? Some of that time was for some search and replace on the transcript output to get rid of trailing and leading spaces and some text characters I don’t care for. :^)


12 posted on 08/03/2024 12:49:40 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: RoosterRedux

Sure, I’ve seen you do that before, it’s particularly handy for really long ones.


13 posted on 08/03/2024 12:51:00 PM PDT by SunkenCiv (That's what *she* said!)
[ Post Reply | Private Reply | To 6 | View Replies]

To: SunkenCiv

Bird Bird Bird Bird is the word...


14 posted on 08/03/2024 12:51:38 PM PDT by null and void (I identify as a conspiracy theorist. My personal pronouns are told/you/so.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: SteveH

lol


15 posted on 08/03/2024 12:51:45 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: SunkenCiv
Here ya go:
Video Transcript:

In The British Museum, we have objects of all sizes. Some pinheads, some gigantic, and everything in between. Once in a while, one of the very smallest things turns out to have information in it which is totally unexpected.

My name is Irving Finkel, and I'm a curator in The British Museum in the Middle East Department, and welcome to my corner.

Curator's Corner with Irving Finkel

So what we have here is a clay tablet. As a matter of fact, it is not a real clay tablet; it is a replica because the real clay tablet has to be on exhibition all the time. Also, it's very delicate. We couldn't wave it around in front of the screen and say, "Look at this, look at that." That would be terribly irresponsible. So we can use this replica for demonstration purposes with impunity.

Ancient Mesopotamian Cuneiform Tablets

The ancient Mesopotamians—Sumerians, Babylonians, all those people—they wrote on clay. That was their natural activity. Clay tablets with impressions of writing on them are pretty good and stable. You can handle them, but you can't play football with them. They're pretty reliable. But in antiquity, there are wars, buildings collapse, fires, and disasters. People die and go away, and other people come and trample on things. When archaeologists find them, it is not often that an ancient inscription on a piece of clay comes to light in perfect condition.

So this tablet, you can easily see that it isn't complete. There's stuff missing here, there's stuff missing there, and it also looks like elephants have danced a polka over the surface because many of the signs are damaged or squashed. But nevertheless, this piece of cuneiform inscription is a remarkable thing.

The oldest map of the world, in the world

This is the oldest map of the world! It has two sides: this is the front or 'obverse,' and this is the back or the 'reverse.' The reverse consists of lots of lines of cuneiform in different ruled sections. So it's full of information, even though it's a bit damaged.

What is the Babylonian Map of the World?

The other side is the remarkable thing. Firstly, there's some lines of cuneiform ruled across very firmly at the top. This is about the early creation of the world and how animals were put in the sea and in different parts of the universe. It's a kind of brief summary of creation, which has nothing to do with the map because there's a clear border between that and this.

And it's this which is so exciting because if you look carefully, you will see that the flat surface of the clay has a double circle drawn in the surface. The double ring is very important because it has cuneiform writing in it which says it's the "Bitter River," and this water was deemed to surround the known world. The area inside the double ring is Ancient Mesopotamia itself. This word 'Mesopotamia' is the Ancient Greek word for what is modern Iraq.

Inside the drawing of this circle, we have very interesting things. There is a great river that runs from north to south, which is the Euphrates River. The river is straddled by a long oblong, which is obviously the city of Babylon. This ring of water was important because it meant for the Babylonians, they had an idea of the limits of their world where they lived in about the 6th century BC, with these important rivers which brought life and food to them, waterways for transport, all the way down to the Persian Gulf. If you look carefully at the picture, you will see that in the surface of the known world, there are these rings drawn with little bits of cuneiform inside those, and those tell you the name of the city it represents or sometimes the tribe.

Encapsulated in this circular diagram is the whole of the known world in which people lived, flourished, and died.

What are the triangles on the Babylonian Map of the World?

However, there's more to this map than that. If you look at the outer ring, you will see that going off at different angles are triangles. Sometimes people say they are islands, sometimes people say they are districts, but in point of fact, they are almost certainly mountains. The idea is that if you go across the water, you see these jutted, pointed things above the horizon, which are remote lands far beyond the limits of the known world. They go out in different directions from the perimeter of existence and are, for the Babylonians, places full of magic and mystery.

When you look at the diagram geometrically, it is evident there were originally eight of them. We can be sure of this partly by calculation of what makes sense and also because the inscription on the other side tells you what is on each of those triangles. There was a place where the sun was never seen, a tree that had jewels instead of fruit, and giant birds that couldn't fly—all those sorts of things. Traditional stories were associated with each of these districts, recorded together with the diagram to show where they were.

Probably nobody ever went there; we're talking about the imaginative world of cosmology, theology, tradition, and inherited ideas. But up until quite recently, we didn't know which description on one side went with which triangle on the front. This was an irksome matter because we knew there were supposed to be eight, but nowhere near eight were visible. We had to work out which place the three we could read clearly matched up with the descriptions on the back, and it wasn't really possible.

Then something happened. One of those missing triangles came to light in the collection.

In the 19th century, when tablets were excavated, they were very careful to bring back everything. A big lump of clay, any small bits lying around it, any small bits not lying around it—anything they could find with writing on was carefully excavated. Sometimes the very small pieces, which we couldn't join to anything, were put in special trays for the long-term future when it might be possible to see what we could do about them.

Edith Horsley - Cuneiform LEGEND

Once upon a time, there was a lady called Edith Horsley. Edith loved cuneiform stuff and came to classes that I used to teach after work once a week to learn about cuneiform. She was very enthusiastic and attentive, and a good student. When the class ended after several months, she said she wanted to do something more.

Channel 4 News report on Babylonian Map of the World September 1995

For as long as anyone can remember, this has been a map with a central piece missing. But from today, no longer. Nicholas Glass reports on an unexpected moment of archaeological excitement in The British Museum.

The British Museum has boxes of tablet fragments, but it's only in the last two months or so, when Edith Horsley was first invited to work at the museum, that they began trying to sort things out. Even as a child, Edith was intrigued by the signs used in cuneiform. But it wasn't until she attended Irving Finkel's lectures that she became an addict.

As a volunteer, Edith comes in just once a week. She was asked to keep an eye out for any piece with a geographical or astronomical image on it. I saw this quite small piece with this triangle on it and the signs inside, and I thought it was probably a map. So I put it in the little section where I put the pieces that I think are of special interest, because Dr. Finkel can't go through all of these trays obviously. I put those aside, and he became quite excited when he saw it.

BABY IRVING!

She put aside a little pile of half a dozen pieces that didn't look like everything else, and I went through them one by one. She said, "Look, this one's got some lines on it." As soon as I saw it, I knew it must belong to this tablet because, as I say, it's such an unusual thing. It's actually rather funny because the map wasn't in its normal place; it was downstairs on exhibition. So I got out an old photograph of it, and the photograph was at a different scale. When I put the fragment on the photograph, I was sure that it must belong, but I couldn't quite see where it would fit. It was only the following morning that I took the fragment downstairs to the exhibition where it's on public view. By looking at the original tablet, I could see straight away that it fitted perfectly in the hole. And it did. As a matter of fact, when I put it in experimentally in the gallery in front of Edith, we couldn't get it out again afterwards. It was such a snug fit, and it had to go down to conservation to be dealt with properly and glued in position.

Having opened a bottle of bubbly and danced around in the gallery, the time came to think very seriously about what this meant. The tablet is very famous; it's often reproduced in all sorts of different encyclopedias and books about ancient ideas and histories of maps. It's quite a famous object, and to make a join to that was an extraordinary thing. But then there was the question of what it told us...

What the missing piece revealed

Against one of the diagonals, there was in cuneiform the expression "The Great Wall." I'm going to read you what the scribe tells us about this triangle: "To the fifth, to which you must travel seven leagues," meaning you have to row across the bitter river for seven leagues before you can land at the foot of the mountain. "The Great Wall, its height is 840 cubits, its trees up to 120 cubits. By day you can't see in front of yourself, by night, lying on..." (it's still broken) "then you must go another seven leagues in the sand and you must..."

There's always dot dot dots because nothing is perfectly preserved. But the important thing is, we now know which of the triangles goes with the description of this gigantic wall. As a result of Edith's discovery, we've got three of these triangles in a row, which is a great boon because you can imagine if you have isolated triangles, trying to match them to the description on the back is very difficult to get anywhere seriously and reliably. But when you've got three in a row, all you have to do is find three descriptions in a row, and it stands to reason that you'll be able to somehow match them up. And that is what we did. The discovery was very clear once you realized that the counting was anti-clockwise, not clockwise.

Number four says, "To the fourth, to which you must travel seven leagues," because it's like a kind of fairytale; everybody knows it's always the same introduction. Each time you have to travel seven leagues across the water. Then it gets a bit broken. Then it says you see something which "are as thick as a parsiktu-vessel."

This parsiktu measurement is something to an Assyriologist which makes their ears prick. The fact is it's only once otherwise known from cuneiform tablets. It's an interesting cuneiform tablet too because it describes the Ark, theoretically built in about 1800 BC by the Babylonian version of Noah. In this account, the details are given, and the God says, "You have to do this, this, and this," and then the Babylonian Noah says, "I did this, this, and this. I've done it! And I made these structures as thick as a parsiktu vessel," he says out of his own mouth in the original story. So this word 'parsiktu' is like a kind of noise that immediately locks into this thing on the map, immediately and incontrovertibly.

Speaking plainly, if I may, it means that if you went up this mountain all the way with your sandwiches and broke regularly for lungfuls of fresh air, eventually you would see against the night sky or the dark sky of the outer universe, silhouetted, the ribs made of wood as thick as a parsiktu vessel of the wreck of the Babylonian Ark, which, like the one in the Bible, came to rest on a mountain. If you come down the mountain and cross over the water back to the homeland, the first place you come to is called 'Urartu,' drawn on the map.

Now, the interesting thing about that is in the Bible, Noah, in his Ark, landed on a mountain where the name is 'Ararat,' and 'Ararat' is the Hebrew equivalent of the Assyrian 'Urartu.' That's quite a meaty thing, quite an interesting thing to think about because it shows that the story was the same, and of course, one led to the other. But also, from the Babylonian point of view, this was a matter of fact. If you did go on this journey, you would see the remnants of this historic boat which saved all the life of the world for the long-term future, from which we, of course, profit today, still there in the crags against the dark sky.

What does it all mean?

So what does this actually mean to us? Let's imagine that we can borrow a time machine and go back to Ancient Mesopotamia. I've always thought this was a good idea; we'll have a party, we'll all go together. When we get there, somebody might say, "Any idea where the Ark is?" And I'll go, "We have the map! Here it is! In fact, it's THERE! That's where it is." What we have to do is get in our rowing boat, off we go, and we will see it for ourselves.

Although this is a map which would not encourage you perhaps to moat across Iraq today in a land rover, when it comes to operating beyond the limits of the known world, into the world of imagination, it's indispensable. So, for the first time, we can pronounce with authority that if we were an ancient Babylonian, we would know where to go to see the remains of that wonderful boat.

Author of Babylonian Map of the World

Then there's the actual question of who wove it together. Often with cuneiform tablets, at the bottom of the reverse, there's a bit that tells you the name of the scribe, what's called the colophon. Unfortunately, the scribe's name is broken. There's no trace of it left. But his father's name is there. In Babylonia, they always said, "Mr. So-and-So, son of Mr. So-and-So." The dad was called Iṣṣuru. 'Iṣṣuru' is the Babylonian word for 'bird.'

This is an interesting thing because we know all about people's names in Mesopotamia. They usually meant something intelligible like ‘Servant of Such and Such a God,’ or ‘She's Beautiful Beyond Compare’ – no one is called Bird. There's no other case of a person called Bird; it's not a very good name! So what does that mean?

If you look at this for the first time in the museum case, which I hope you will now do, and peer through and make out the details, you would think, "Ah! I see, it's a sort of birds-eye view of the world!" Well, I think that's what it is. It's a Birdy Birdy family, and this is a birds-eye view of the known world and what lies beyond it.

This gives it a special kind of warmth of understanding. Because its failings, as it were, from a cartographical point of view, are irrelevant. It's not what they're interested in. And it's given us a tremendous insight into many aspects of Mesopotamian thinking. It's also a triumphant demonstration of what happens when you have a very small, totally uninformative, and useless fragment of dead boring writing that no one can understand, and you join it onto something in the collection which is much bigger, and a whole new adventure begins all over again!

Hey you! Cuneiform nerd! Do you want some more cuneiform? Of course you do. Below is a playlist full of all the videos we've ever made concerning cuneiform. You can see in the top left corner right now a preview of the next episode of Curator's Corner, which also covers cuneiform. We are going to the ancient Sumerian city of Girsu in southern Iraq, where Sebastien Rey will talk you through two bricks that were found in the same building. That's pretty normal; buildings are made of bricks. The weird thing is, these bricks were made 1500 years apart from each other but were in the same building. Also, crazy thing, Sebastien's excavated both of these bricks, but one of those bricks has been excavated twice previously. The first time it was excavated was 2300 years ago! Archaeology is weird.


16 posted on 08/03/2024 1:01:02 PM PDT by RoosterRedux (“Thinking is difficult, that’s why people prefer to judge”, wrote Carl Gustav Jung.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: SunkenCiv

Ark welding is messy and has largely been replaced by MIG and TIG welders


17 posted on 08/03/2024 1:02:33 PM PDT by bert ( (KE. NP. +12) Where is ZORRO when California so desperately needs him?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Fester Chugabrew; ComputerGuy

Cracking cuneiform seems like a terrifically difficult accomplishment, and I really still think it was, much worse than Egyptian hieroglyphs.

A large archive was excavated. None of it could be read, but the patterns of signs made it possible to discern that a number of languages were recorded using the same writing system.

Two languages comprised the bulk of the archive.

The first one to succumb was Akkadian. As an extinct Semitic language, it had living relatives and familiar structures. After it was cracked, it was realized that the little stylized pictures used for the characters didn’t work as mnemonics of the word/sound that is found in Akkadian.

However, this development meant that even inscriptions in unknown languages could be pronounced and read aloud. It became clear that the other large collection of one language was the original for which cuneiform was devised — Sumerian. Sumerian is a language isolate, had and has no known related tongues. Its agglutinative structure was discerned.

The late Samuel Noah Cramer notes in his general reader book on the Sumerians that the rivers and even the cities in which they lived had non-Sumerian names, and that these names are likely to be loanwords from the earlier inhabitants who spoke one or more unknown and vanished languages.

The Sumerians didn’t say much about their origins, apart from the idea that their first presence in Mesopotamia was a known city on the shore of what’s now the Persian Gulf; they called themselves “the black-headed people”; they were skilled with numbers, but each city-state used a different system to write them.

https://search.brave.com/search?q=who+cracked+cuneiform&summary=1


18 posted on 08/03/2024 1:06:57 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: RoosterRedux

Ooh, nice! I’m grabbin’ that for my file.


19 posted on 08/03/2024 1:07:26 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 16 | View Replies]

To: AdmSmith

Definitely!


20 posted on 08/03/2024 1:09:39 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 5 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-52 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson