Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Why don’t humans have tails? Scientists find answers in an unlikely place
Accuweather ^ | Mar 25, 2024 1:55 PM CDT | By Mindy Weisberger, CNN

Posted on 03/27/2024 12:13:10 PM PDT by Red Badger

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-60 last
To: BamaBelle

not r rated...typo


41 posted on 03/27/2024 2:39:18 PM PDT by BamaBelle
[ Post Reply | Private Reply | To 39 | View Replies]

To: Red Badger

Now explain the Long Ears and the Short Ears of Easter Island.


42 posted on 03/27/2024 2:50:02 PM PDT by Ruy Dias de Bivar
[ Post Reply | Private Reply | To 21 | View Replies]

To: Ruy Dias de Bivar

Earrings..........


43 posted on 03/27/2024 3:13:27 PM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 42 | View Replies]

To: Vaduz
Indeed if we came form monkeys they wouldn’t still be around it’s how evolution works.

Be careful with this line of argument. Evolutionists religion teaches that man and monkeys had a common ancestor x billion number of years ago and man branched off that common ancestors as did monkeys and they "evolved" separately after that.

44 posted on 03/27/2024 3:17:16 PM PDT by DouglasKC
[ Post Reply | Private Reply | To 29 | View Replies]

To: Red Badger

FYI

Already known that “junk DNA/genes” are in the “junk” heap of biological speculation....

“Jumping genes” also known as transposons and even retrotransposons...whad’ya know?

Humans became tailless so they could have one less avenue for escape from predators and one less way to get food from trees...


45 posted on 03/27/2024 4:15:42 PM PDT by Getready (Wisdom is more valuable than gold and harder to find.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Yeah yeah, but for real science, I identify as having a tail ... so you better accept that its real and pretend like you can see it.


46 posted on 03/27/2024 4:38:19 PM PDT by RainMan ((Democrats ... making war against America since April 12, 1861))
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

No great ape has a tail, and the hairless one is the only one that is entirely bipedal.


47 posted on 03/27/2024 4:44:02 PM PDT by Paal Gulli
[ Post Reply | Private Reply | To 2 | View Replies]

To: EEGator

You made me think of this commercial. https://www.youtube.com/watch?v=KvtPuWtmNPM


48 posted on 03/27/2024 4:55:51 PM PDT by EvilCapitalist (Pets are no substitute for children)
[ Post Reply | Private Reply | To 5 | View Replies]

To: EvilCapitalist

Ha.


49 posted on 03/27/2024 4:58:24 PM PDT by EEGator
[ Post Reply | Private Reply | To 48 | View Replies]

To: DouglasKC

Np real data for common ancestor between monkeys and humans but a lot of speculation.

Tracing something back to the fork in the road and coming up with an unproven data isn’t science.


50 posted on 03/28/2024 6:41:28 AM PDT by Vaduz
[ Post Reply | Private Reply | To 44 | View Replies]

To: Red Badger; StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; ...
Thanks Red Badger. We got no class. We got no principles. We got no innocence. We can't even think up a world to rhyme. That's from my late childhood and early teens, when we had nothin' but tail on our minds at least part of the time.
Alu elements are abundant in human DNA; the insertion in TBXT is “literally one out of a million that we have in our genome,” Yanai said. But while most researchers had dismissed TBXT’s Alu insertion as junk DNA, Xia noticed its proximity to a neighboring Alu element. He suspected that if they paired up, it could trigger a process disrupting protein production in the TBXT gene.

51 posted on 03/28/2024 8:24:36 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

School’s out forever!.......................


52 posted on 03/28/2024 8:26:17 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Red Badger
A long sad tail:


53 posted on 03/28/2024 9:05:24 AM PDT by null and void (There’s only one thing that’s for sure. Everyone on all sides a conflict will be happy to lie to you)
[ Post Reply | Private Reply | To 1 | View Replies]

To: null and void

54 posted on 03/28/2024 9:10:49 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 53 | View Replies]

To: Red Badger; piasa
And Manx Cats?...............

Also Schipperke...

55 posted on 03/28/2024 9:10:57 AM PDT by null and void (There’s only one thing that’s for sure. Everyone on all sides a conflict will be happy to lie to you)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Vaduz
Indeed if we came form monkeys they wouldn’t still be around it’s how evolution works.

Indeed if we came from Europeans, they wouldn't still be around. It's how evolution works.

56 posted on 03/28/2024 9:16:17 AM PDT by null and void (There’s only one thing that’s for sure. Everyone on all sides a conflict will be happy to lie to you)
[ Post Reply | Private Reply | To 29 | View Replies]

To: piasa
I wonder if rabbits, bobcat and lynx have the same issue explaining their stubby tails.

A good question and one that can be investigated relatively easily.
https://www.nature.com/articles/s41586-024-07095-8

57 posted on 03/28/2024 12:31:25 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11 | View Replies]

To: null and void

Evolution has peaked so far no missing link has been found that we came from monkeys.

Europeans are still be around and doing well.


58 posted on 03/28/2024 1:42:18 PM PDT by Vaduz
[ Post Reply | Private Reply | To 56 | View Replies]

To: Red Badger

https://search.brave.com/search?q=vestigial+tail

https://www.google.com/search?q=vestigial+tail

Eric’s sister Lori Forman was born with one.


59 posted on 03/28/2024 3:00:14 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: DouglasKC

Made from dust...


60 posted on 03/28/2024 6:43:06 PM PDT by SuzyQue
[ Post Reply | Private Reply | To 3 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-60 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson