Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 07/20/2023 11:03:40 AM PDT by Red Badger
[ Post Reply | Private Reply | View Replies ]


To: Red Badger

Yes. I had Covid and never had any symptoms. Just as I had very few (almost never) cases of “flu” after childhood.

The idea that everyone is eqqually vulnerable to everything is flat out wrong.


2 posted on 07/20/2023 11:08:46 AM PDT by Wuli
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger
The researchers warned that most of the study's participants were white,

Ah Geez, the Dems are going to throw a fit.

3 posted on 07/20/2023 11:12:09 AM PDT by 1Old Pro
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

The first sign is lack of a Covid vaccine card in their possession.


4 posted on 07/20/2023 11:19:51 AM PDT by ilgipper (The mob only destroys. Never creates. )
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

It would be interesting to know what part of the world these HLA folks’ predecessors came from...Northern European? Mediterranean? Where?


5 posted on 07/20/2023 11:20:05 AM PDT by ryderann
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

This is how we survive the really bad diseases, the ones that nobody has any level of ordinary “natural immunity” to (which comes from immune system familiarity, not a genetic mutation).

If such a virus hits, then potentially everyone could die, except in a large population, there will probably be some people with a genetic anomaly like this, that does give them immunity. Then, even if the other 90% of the population should perish, the remaining would repopulate, and close to 100% of their descendants would inherit the immunity.


6 posted on 07/20/2023 11:23:49 AM PDT by Boogieman
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Good, they are finally getting into some possible good data.

2 of our dils and 2 semi dils (their husbands adopted my wife and I), never had Covid except maybe like a 24 hour cold. Nor were they vaccinated.

Yet, their husbands, who slept with them, ate with them, and lived with their spouses having Covid and Covid symptoms and never passed their Covid to their adult women nor their children at home, including 2 kids in college and away from home except for holiday visits with sick dads and no one else with Covid.


8 posted on 07/20/2023 11:29:02 AM PDT by Grampa Dave (,We have number of experts, stating B$ as fact, & they have no idea nor reality or solutions!!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

I attribute my success at being china virus free to not owning a TV.


9 posted on 07/20/2023 11:29:14 AM PDT by Track9 (You are far too inquisitive not to be seduced…)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger
My wife comes from a very large family, who in turn have had very large families. Every time a gathering was planned, everyone went out and tested for Covid. Every time a dozen or so would test positive for covid and everyone got all upset, worried, got more jabs, locked themselves up.

After a year of this when one would tell my wife they were going to test for covid, I managed to get her to ask, "Why?". "Are you sick?" They would go nuclear and lecture my wife on public health responsibility.

Fast forward another six months and they all stopped their collective insanity. Coincidentally they all stopped at the exact same time cruises resumed. They all love going on cruise ships. I figure their concern for public health was tossed aside when their dry spell on vacations finally got to them.

10 posted on 07/20/2023 11:31:08 AM PDT by blackdog ((Z28.310) My dog Sam eats purple flowers.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

I have been blessed- despite having some risk factors and being exposed 3 times- once at work, and twice at home on 2 separate occasions 10 months apart- first caring for my husband and then my mother in law- I never got sick or had positive home test. I have done the highly recommended supplement protocol. It must be old age though because sometime in past 2 years I stopped being able to taste coffee- it just doesn’t taste like coffee to me anymore.


13 posted on 07/20/2023 11:49:48 AM PDT by dkGba
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

It’s like an entire class of virologists are learning on the job what they should’ve learned in college.

And it’s like an entire class of virologists are trying to figure out why COVID wasn’t as potent as Fauci asked it to be.


17 posted on 07/20/2023 11:52:39 AM PDT by rarestia (“A nation which can prefer disgrace to danger is prepared for a master, and deserves one.” -Hamilton)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Never had covid AFIAK (never tested or vaxxed).

Early on there was research showing that tetanus vaccines seemed to reduce change of covid infection by 15%-25%, or so. I had a recent tetanus booster so I had that going for me.

Also, I read a study that indicated that persons infected by the common cold coronavirus were resistant to SARS2 as well. This was a smallish study (still waiting for the FDA or big pharma to fund a larger study...) but none of the subjects that had been exposed to common-cold coronavirus in the past got covid.


22 posted on 07/20/2023 12:05:29 PM PDT by 13foxtrot
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

“...twice as likely to never get sick...”
Can someone express this differently? Maybe in a mathematical formula?
The sentence structure is horrible, etc.
But I don’t know what they mean.


23 posted on 07/20/2023 12:07:49 PM PDT by Honest Nigerian
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

RFKjr was correct.


27 posted on 07/20/2023 12:48:09 PM PDT by MarMema
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Correlation is not causation.


31 posted on 07/20/2023 2:12:57 PM PDT by 9YearLurker
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Let me guess, it has something to do with being Jewish.


33 posted on 07/20/2023 2:57:38 PM PDT by Rural_Michigan
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

I did not wear a mask except the short time it took to clean out my desk at work when I retired in nov ‘21. The 2 story building was nearly empty that once had about 300 people there. Only the admin people and front desk person wearing a mask and some payroll people were there and the payroll dept had people with and without masks...

I have not had the sniffles for several years going back prior to march 2020. I take zinc and vitamin D3 and the B vitamins. I have ivermectin pills as a backup.

My 34 year old nephew was killed by the vaccine last sept 2022 in Minnesota where the doctors would put cause of death but it was found the CDC would change the code so it would not say the vaccine.


37 posted on 07/20/2023 3:47:39 PM PDT by minnesota_bound (Need more money to buy everything now)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger; SunkenCiv
Out of that group, 136 saw no COVID-19 symptoms two weeks before and after testing positive. One in five of that group carried at least one copy of an HLA variant called HLA-B*15:01. Those fortunate enough to have two copies of the gene — one from their mother, one from their father — were over eight times more likely to be asymptomatic from COVID-19 than other people, the study said.

It is not that easy, either Scylla or Charybdis:

The human leukocyte antigen (HLA) haplotype DRB1*15:01 is the major risk factor for multiple sclerosis (MS).

https://www.nature.com/articles/s41467-018-04732-5

52 posted on 07/22/2023 12:04:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson