Free Republic
Browse · Search
General/Chat
Topics · Post Article

Just as one can build a 'cell phone tree', this would allow investigators to find those who might still be on the loose in this attack.
1 posted on 07/15/2016 12:19:40 AM PDT by topher
[ Post Reply | Private Reply | View Replies ]


To: topher

I may get ‘roasted’ for this posting, but if the information was available, it might be a way to break up multiple terrorist cells.


2 posted on 07/15/2016 12:21:50 AM PDT by topher (Traditional values -- especially family values -- which have been proven over time.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Yes, there probably are finger prints all over the place; however, those guns are TOYS and the hand grenade a dud.


4 posted on 07/15/2016 12:28:05 AM PDT by nopardons
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Interpol HQ is a 4 and a half hour drive from Nice.


5 posted on 07/15/2016 12:31:41 AM PDT by Hillarys Gate Cult (Liberals make unrealistic demands on reality and reality doesn't oblige them.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

much easier to make connections based on location/addresses. feds just won’t do it.


6 posted on 07/15/2016 12:41:42 AM PDT by kvanbrunt2
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

It would force these savages to wear gloves so they wouldn’t leave fingerprints. That would be funny if The Prophet forbade gloves because, at the time, they were all made from pig skin. LOL!


7 posted on 07/15/2016 12:46:39 AM PDT by jonrick46 (The Left has a mental disorder: A totalitarian mindset..)
[ Post Reply | Private Reply | To 1 | View Replies ]

Yet the maniac deployed his ride to commit the outrageous homicide.

Islam is a war plan.


8 posted on 07/15/2016 12:48:11 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Latest: At least 84 dead. As of Friday 8 a.m. local time, 18 individuals were in critical condition, 50 were lightly injured, and 120 were receiving treatment, according to a spokesman for the Ministry of the Interior. Prior to the announcement Friday morning that 84 had died, the death toll had been 80.

At least two Americans were killed.

http://www.dailymail.co.uk/news/article-3691392/American-father-son-believed-84-killed-Nice-terrorist-drove-truck-packed-guns-explosives-crowd-celebrating-Bastille-Day.html


13 posted on 07/15/2016 1:33:20 AM PDT by Hillarys Gate Cult (Liberals make unrealistic demands on reality and reality doesn't oblige them.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

14 posted on 07/15/2016 1:35:02 AM PDT by Telepathic Intruder (The only thing the Left has learned from the failures of socialism is not to call it that)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

DNA data base on all citizens?

Even if?

Really too little, too late.

The terrorists? We have to kill them all.


17 posted on 07/15/2016 2:07:39 AM PDT by Candor7 ( Obama fascism article:(http://www.americanthinker.com/2009/05/barack_obama_the_quintessentia_1.html)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Excellent idea!

I’m pretty confident that they will not take your advice.

If there is a “New World Order” plan, the Muslim Brotherhood is in charge.


18 posted on 07/15/2016 2:08:51 AM PDT by airborne (I don't always scream at the TV but when I do it's hockey playoffs season!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Wouldn’t surprise me if some of the weapons traced back to Fasr and Furious.


20 posted on 07/15/2016 3:06:12 AM PDT by Flick Lives (TRIGGER WARNING - Posts may require application of sarcasm filter)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Truck also had bullet proof windshield; police did not search truck prior to delivering “ice cream”; nor did the police have weapons capable of stopping the truck or penetrating the windscreen.

Other attackers are muslims located in France’s vast muslim enclaves - no terror will be stopped until all muslims are removed from French soil ...


21 posted on 07/15/2016 3:53:32 AM PDT by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher; SunkenCiv
Europe should consider fingerprinting/getting DNA on all immigrants and even current citizens.

Already done:

The EURODAC database contains fingerprints of asylum seekers in the EU, persons who illegally crossed the borders of the EU or have been caught illegally on the territory of a Member State. By comparing fingerprints, a Member State may determine if an asylum seeker, a person caught crossing the EU border illegally or a person caught illegally on the territory of an EU Member State, applied for asylum in another Member State.
http://www.eppgroup.eu/press-release/EURODAC-fingerprints-database

The EU is planning wholesale changes to the bloc’s asylum law. In addition to a “fairer” distribution system for refugees and an extension of border controls within the Schengen area, the Eurodac fingerprint database, which is currently used to identify asylum seekers and irregular migrants, is to be enlarged.

The system is set to be supplemented with facial recognition software and personal data will be stored for a longer period of time, with the aim of ensuring that irregular migrants stay on the authorities’ radar; the information of underage refugees will also be kept.

http://www.euractiv.com/section/justice-home-affairs/news/eu-proposes-minority-report-style-facial-recognition-for-refugees/

25 posted on 07/15/2016 4:22:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

They won’t do it, they might offend the Muslim’s.


26 posted on 07/15/2016 4:50:12 AM PDT by fortheDeclaration (Pr 14:34 Righteousness exalteth a nation:but sin is a reproach to any people)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Something for French patriots to think about:

If jihadists can find and buy rifles and grenades, so can French patriots.


27 posted on 07/15/2016 4:54:53 AM PDT by sergeantdave
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Check the credit card for renting the truck. Name on it is probably George Soris.


29 posted on 07/15/2016 6:33:24 AM PDT by ThePatriotsFlag ( Anything FREELY-GIVEN by the government was TAKEN from someone else.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

I wonder if any of these are Fast ‘n’ Furious oopsies that were smuggled across the pond from Mexico?


36 posted on 07/15/2016 9:06:43 AM PDT by Sirius Lee (If Trump loses, America dies)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: topher

Limiting it to recent arrivals wouldn’t be at all effective in Europe. Lots of second and third generation immigrants from North Africa in France.


38 posted on 07/15/2016 9:14:37 AM PDT by semimojo
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson