Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

DNA from humans, rats and other animals found in some veggie burgers
Fox news ^ | May 11, 2016

Posted on 05/11/2016 3:10:44 PM PDT by SMGFan

A new report from Clear Labs — the same food analysts who found that at least 10 percent of vegetarian hot dogs contain meat — suggests some troubling things about the making of veggie burgers.

In a sample of 89 veggie burgers collected from a range of brands, Clear Labs identified several problems with “substitution, hygienic issues, and pathogenic contamination.”

(Excerpt) Read more at foxnews.com ...


TOPICS: Food
KEYWORDS:
Navigation: use the links below to view more comments.
first previous 1-2021-36 last
To: SMGFan
Veggie burger: Is that a loofah?
21 posted on 05/11/2016 3:47:47 PM PDT by kosciusko51
[ Post Reply | Private Reply | To 1 | View Replies]

To: SMGFan

My veg head friend and I used to frequent a food truck. He said they had the best veggie burgers, I knew why too. They fried them in bacon fat.


22 posted on 05/11/2016 4:15:24 PM PDT by VTenigma (The Democratic party is the party of the mathematically challenged)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VTenigma

Double win!

Muslim repellant LOL


23 posted on 05/11/2016 4:16:43 PM PDT by nascarnation
[ Post Reply | Private Reply | To 22 | View Replies]

To: SMGFan
The fact is there is NEVER going to be a truly 100% vegan burger.

Even water has microscopic animals in it.

I know of some Orthodox Jews who would filter NYC water, because the miniature insects in it would definitely be non-kosher.

You can try, but NO food is completely insect-free.

24 posted on 05/11/2016 4:35:28 PM PDT by boop ("A Republic, if you can keep it."-Franklin, 1787. "We couldn't keep it"-America, 2016)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VTenigma
It might have been here on FR, but someone mentioned a Muslim friend who enjoyed pizza.

Someone mentioned that pepperoni contains pork and he became very sad.

"That's a shame. I loved it so much."

25 posted on 05/11/2016 4:43:29 PM PDT by boop ("A Republic, if you can keep it."-Franklin, 1787. "We couldn't keep it"-America, 2016)
[ Post Reply | Private Reply | To 22 | View Replies]

To: SMGFan

Put some Open Pit on it, and its all good.


26 posted on 05/11/2016 4:47:24 PM PDT by MotorCityBuck ( Keep the change, you filthy animal! ,)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SMGFan

Just more media BS

Veggie Burgers are often made in hamburger plants that process meat, albeit under different regulations. If human hands picked or processed those beans, onions, carrots, etc... then human DNA could likely be found on them.


27 posted on 05/11/2016 4:52:16 PM PDT by PGR88
[ Post Reply | Private Reply | To 1 | View Replies]

To: SMGFan

Things fall in at the factory. People lose fingers once in awhile.


28 posted on 05/11/2016 4:58:13 PM PDT by Secret Agent Man (Gone Galt; Not averse to Going Bronson.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Above My Pay Grade
In a Charlton Heston voice: “Veggie burgers are PEOPLE! (and rats)”

LOL - that's Great!

29 posted on 05/11/2016 5:23:59 PM PDT by libertarian27 (FR Cookbooks - On Profile Page)
[ Post Reply | Private Reply | To 18 | View Replies]

To: SMGFan

I’m vegan and have never had one of these things. I get so amused at vegans and vegetarians who eat processed food like veggie burgers. Most I’ve met are the unhealthiest eaters.


30 posted on 05/11/2016 5:45:13 PM PDT by goodwithagun (March 3, 2016: The date FReepers justified the "goodness" of Planned Parenthood.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Secret Agent Man

And employees don’t wash their hands or lick their fingers after using the restrooms!


31 posted on 05/11/2016 6:23:56 PM PDT by RetiredTexasVet (The answer: To frustrate FOIA requests and conceal the money laundering of bribes thru the CGCI!)
[ Post Reply | Private Reply | To 28 | View Replies]

To: grania

Why the human DNA? spit? poopy? chopped off fingers? plants genetically engineered with human DNA?


32 posted on 05/11/2016 9:24:32 PM PDT by TEXOKIE (We must surrender only to our Holy God and never to the evil that has befallen us.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: SunkenCiv; SMGFan

For every year the detection systems get better, we can measure minuscule quantities of any substance. Statistically, my beer contains molecules that once were in the body of Cleopatra.


33 posted on 05/12/2016 12:49:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4 | View Replies]

To: AdmSmith

“Husband, are you drinking *again*?!?”

“Well, technically, I’m doing some research into Cleopatra.”


34 posted on 05/12/2016 4:56:39 AM PDT by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | To 33 | View Replies]

To: SunkenCiv

LOL!


35 posted on 05/12/2016 6:12:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 34 | View Replies]

To: libertarian27
some text
36 posted on 05/12/2016 6:56:58 AM PDT by yuleeyahoo (There's no limit to the amount of good you can do if you don't care who gets the credit - R. Reagan)
[ Post Reply | Private Reply | To 29 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-36 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson