Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: Candor7
Some of the cell phones comprise health risks through radiation. Too many users have contracted tumors in the ear area, not to notice.

Please provide proof of your assertions. Not anecdotal. PROOF.

In the meantime, the American Cancer Society has this to say about cell phone signals.

As noted above, the RF waves given off by cell phones don’t have enough energy to damage DNA directly or to heat body tissues. Because of this, many scientists believe that cell phones aren’t able to cause cancer. Most studies done in the lab have supported this theory, finding that RF waves do not cause DNA damage.

Some scientists have reported that the RF waves from cell phones produce effects in human cells (in lab dishes) that might possibly help tumors grow. However, several studies in rats and mice have looked at whether RF energy might promote the development of tumors caused by other known carcinogens (cancer-causing agents). These studies did not find evidence of tumor promotion.


22 posted on 01/25/2015 1:00:55 AM PST by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users contnue...)
[ Post Reply | Private Reply | To 10 | View Replies ]


To: Swordmaker; Candor7
In order to break a chemical bond in the human body you need an energy of a few eV. http://en.wikipedia.org/wiki/Bond-dissociation_energy

The energy from cell phones are more than 1000 times smaller http://en.wikipedia.org/wiki/Microwave so there is no risk from that. The content of the phone call might be harmful though ;-)

29 posted on 01/25/2015 2:51:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson