Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith

Thanks for the links. I appreciate them. Dr. Miklossy points out in her paper that these oral spirochetes are capable of triggering the human immune response for their OWN defense. After reading the first paper on inflammation, and it’s involvement, I wonder if that is not part of the AD modality?


227 posted on 10/19/2011 11:07:59 AM PDT by Swordmaker (This tag line is a Microsoft product "insult" free zone.)
[ Post Reply | Private Reply | To 226 | View Replies ]


To: Swordmaker

Yes, it is a strong possibility


228 posted on 10/20/2011 12:46:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 227 | View Replies ]

To: Swordmaker
Anything new from the clinic? I checked recent articles:

Oral spirochetes implicated in dental diseases are widespread in normal human subjects and carry extremely diverse integron gene cassettes.
http://www.ncbi.nlm.nih.gov/pubmed/22635997

The psychoimmunology of lyme/tick-borne diseases and its association with neuropsychiatric symptoms.
http://www.ncbi.nlm.nih.gov/pubmed/23091569

The oral microbiome in health and disease.
http://www.ncbi.nlm.nih.gov/pubmed/23201354

Evidence for graft colonization with periodontal pathogens in lung transplant recipients. A pilot study.
http://www.ncbi.nlm.nih.gov/pubmed/22203528

Simultaneous detection of periodontal pathogens in subgingival plaque and placenta of women with hypertension in pregnancy.
http://www.ncbi.nlm.nih.gov/pubmed/21830010

Emerging roles of pathogens in Alzheimer disease.
http://www.ncbi.nlm.nih.gov/pubmed/21933454

Exploring new biological functions of amyloids: bacteria cell agglutination mediated by host protein aggregation.
http://www.ncbi.nlm.nih.gov/pubmed/23133388

Periodontal vaccine.
http://www.ncbi.nlm.nih.gov/pubmed/22406716

234 posted on 12/15/2012 2:34:29 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 227 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson