Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith

So what? They inserted some sequences in the genome?

Big deal. They can do that already with viral vector technology.

This was not “creating life” by any stretch.


83 posted on 05/23/2010 5:07:05 AM PDT by djf
[ Post Reply | Private Reply | To 80 | View Replies ]


To: djf; neverdem
This was not “creating life” by any stretch.
No, we all know that, but the headline was written by an ignorant journalist.
86 posted on 05/23/2010 5:29:33 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 83 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson