Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

New Study Shows Tyrannosaurus Rex Evolved Advanced Bird-Like Binocular Vision
Science News Online ^ | June 26 2006 | Eric Jbaffe

Posted on 07/03/2006 12:32:51 PM PDT by Al Simmons

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 601-620621-640641-660 ... 701 next last
To: Southack
That was a wisecrack. I am not qualified to take part in a discussion of higher math because, owing to the overdevelopment of the other parts of my brain, the math part got squeezed out.....

*LOL*

BTW, are you in Europe or do you have the same insomnia I've currently got????

621 posted on 07/08/2006 1:29:40 AM PDT by Al Simmons (Hillary Clinton is Stalin in a Dress)
[ Post Reply | Private Reply | To 620 | View Replies]

To: Southack
Incorrect. Nice of you to just join up to post such rubbish, though.

It's a shame that you chose to become personal so quickly . How long ago I signed up does not affect whether I am right or wrong.

AA is 1 base pair out of 1953 in the bacteria gene under debate.

A does not pair with A. A pairs with T. And when we list a genetic sequence, we don't usually give the complementary bases, because anyone who knows the rudiments can figure out what the complementary strand is. So AA pairs with TT.

You evolutionists need to bone up on simple math.

If you don't understand the structure of DNA, you are going to make mistakes even before you get to doing any math.

By the way, because pairs such as AG & GA could be seen as duplicates, the formula that I gave in the earlier post for 3^1953 was used instead of 6^1953.

DNA strands have a direction. They are by convention given from 5' end to 3' end. So AG is not the same as GA, and they can't be 'seen as duplicates', unless you don't understand the chemical structure of DNA.

I hope you don't think it's impolite for me to suggest that you should learn some elementary molecular biology before you try to argue about it.

622 posted on 07/08/2006 7:00:10 AM PDT by DanDenDar
[ Post Reply | Private Reply | To 618 | View Replies]

To: DanDenDar

Let's say we have 2 bases, and the original sequence is AA. Then the list of sequences accessible by a single point mutation is (AT, AG, AC, TA, GA, CA). That's six, which is 3*2, not 3^2.

If we have three bases, starting from AAA, we get (AAT, AAG, AAC, ATA, AGA, ACA, TAA, GAA, CAA). That's 3*3 = 9, not 3^3 = 27. And so on. You do know * is a multiplication sign, right?
617 posted on 07/07/2006 9:43:05 PM CDT by DanDenDar

 
 
A does not pair with A. A pairs with T. And when we list a genetic sequence, we don't usually give the complementary bases, because anyone who knows the rudiments can figure out what the complementary strand is. So AA pairs with TT.
622 posted on 07/08/2006 9:00:10 AM CDT by DanDenDar

Oh, brother.

Dan, Dan, Dan...

"AAA" doesn't equal 3 base pairs. "AA" does not equal 2 base pairs.

So you got the biology wrong. Then after listing "AA" you contracted yourself with "A does not pair with A."

Then you got the math wrong: it's not 3*1953, it's 3^1953.

Congrats. You're 0 for 3.

623 posted on 07/08/2006 11:20:38 AM PDT by Southack (Media Bias means that Castro won't be punished for Cuban war crimes against Black Angolans in Africa)
[ Post Reply | Private Reply | To 622 | View Replies]

To: Southack

There are n = 3*1953 = about 6000 single-point mutations. There are about n^2 two-point mutations. 6000^2 = 36,000,000 is close enuff to 20,000,000. So it looks like every mutation that differed at one or two locations occurrred.


624 posted on 07/08/2006 1:28:59 PM PDT by Virginia-American
[ Post Reply | Private Reply | To 598 | View Replies]

To: Virginia-American; js1138

No, js1138's claim was that every possible point mutation occurred and was observed in the experiment. See post #577.

You are trying to re-state the initial claim as if having a mutation at each point was the same as having every possible point mutation at every point.

Disingenuous.

625 posted on 07/08/2006 2:01:14 PM PDT by Southack (Media Bias means that Castro won't be punished for Cuban war crimes against Black Angolans in Africa)
[ Post Reply | Private Reply | To 624 | View Replies]

To: Virginia-American
Why didn't you just tell him that in the case of a single nucleotide (not a base pair) *at a time* change, calculating a permutation is not applicable?

A longer sequence makes it easier to see.

From the initial sequence:
agtcctgagtctacgtatcgata

We get the following single nuceotide changes:
agtcctaagtctacgtatcgata
agtccttagtctacgtatcgata
agtcctcagtctacgtatcgata
agtcctgggtctacgtatcgata
agtcctgtgtctacgtatcgata

agtcctgcgtctacgtatcgata

agtcctgaatctacgtatcgata
agtcctgattctacgtatcgata
agtcctgactctacgtatcgata

3*3=9 single nucleotide mutations

From his we would get, in addition to all of the above:
agtcctaggtctacgtatcgata
agtcctatgtctacgtatcgata
agtcctacgtctacgtatcgata
agtcctaaatctacgtatcgata
agtcctaattctacgtatcgata
agtcctaactctacgtatcgata
agtcctagatctacgtatcgata
agtcctatatctacgtatcgata
agtcctacatctacgtatcgata
agtcctaggtctacgtatcgata
agtcctagttctacgtatcgata
agtcctagctctacgtatcgata
.
.
.
.
And so on...
until will get all permutations of those three nucleotides (minus duplicates) many of which are *not* single nucleotide mutations.
33=27 multiple nucleotide mutations

626 posted on 07/08/2006 9:58:35 PM PDT by b_sharp (Why bother with a tagline? Even they eventually wear out!)
[ Post Reply | Private Reply | To 624 | View Replies]

To: Southack

Troll elsewhere, dude. You're not even amusing.


627 posted on 07/09/2006 3:10:34 PM PDT by DanDenDar
[ Post Reply | Private Reply | To 623 | View Replies]

To: DanDenDar; b_sharp
33=27 multiple nucleotide mutations
626 posted on 07/08/2006 11:58:35 PM CDT by b_sharp (Why bother with a tagline? Even they eventually wear out!)
 
 
If we have three bases, starting from AAA, we get (AAT, AAG, AAC, ATA, AGA, ACA, TAA, GAA, CAA). That's 3*3 = 9, not 3^3 = 27. And so on. You do know * is a multiplication sign, right?
617 posted on 07/07/2006 9:43:05 PM CDT by DanDenDar

628 posted on 07/09/2006 3:19:56 PM PDT by Southack (Media Bias means that Castro won't be punished for Cuban war crimes against Black Angolans in Africa)
[ Post Reply | Private Reply | To 627 | View Replies]

To: Southack
He said multiple nucleotide mutations. I said single point mutations.

Tell the truth, dude. The alternative, well, you know what that makes you?

629 posted on 07/09/2006 3:29:51 PM PDT by DanDenDar
[ Post Reply | Private Reply | To 628 | View Replies]

To: DanDenDar; js1138
"He said multiple nucleotide mutations. I said single point mutations."

You don't even know the point under debate...

There have been very recent experiments in heat resistant bacteria in which every possible point mutation in the relevant genes was observed. Therefore there are at least some instances in which the source of variation -- random or not -- is irrelevant. ...

577 posted on 07/06/2006 10:47:48 PM CDT by js1138 ...

630 posted on 07/09/2006 3:34:41 PM PDT by Southack (Media Bias means that Castro won't be punished for Cuban war crimes against Black Angolans in Africa)
[ Post Reply | Private Reply | To 629 | View Replies]

To: Southack
A point mutation is one point, dude. Go beam up to another universe where points mean somthing else.

Or just try to be an man in this one, and admit you were wrong.

631 posted on 07/09/2006 3:59:33 PM PDT by DanDenDar
[ Post Reply | Private Reply | To 630 | View Replies]

To: DanDenDar

"every possible point mutation"


632 posted on 07/09/2006 4:04:21 PM PDT by Southack (Media Bias means that Castro won't be punished for Cuban war crimes against Black Angolans in Africa)
[ Post Reply | Private Reply | To 631 | View Replies]

To: Southack

I'm sorry, dude.


633 posted on 07/09/2006 4:31:30 PM PDT by DanDenDar
[ Post Reply | Private Reply | To 632 | View Replies]

To: DanDenDar

It's OK. Most evolutionists botch the biology and the math, just like you did. I seldom expect more.

...the others tend to have more clever, more original insults than you, though.

634 posted on 07/09/2006 5:25:30 PM PDT by Southack (Media Bias means that Castro won't be punished for Cuban war crimes against Black Angolans in Africa)
[ Post Reply | Private Reply | To 633 | View Replies]

To: DanDenDar
Troll elsewhere, dude. You're not even amusing.

Dude? What, are you 12?

635 posted on 07/09/2006 5:35:51 PM PDT by Jean S
[ Post Reply | Private Reply | To 627 | View Replies]

To: JeanS
Dude? What, are you 12?

What are you, 98?

636 posted on 07/10/2006 4:51:27 AM PDT by DanDenDar
[ Post Reply | Private Reply | To 635 | View Replies]

To: Southack; DanDenDar; js1138
A point mutation is a single nucleotide change or indel. That means that the rest of the DNA strand remains unchanged. The calculation you perform results in segments of the strand that range from a single nucleotide to the entire strand changing. If we are to only consider those mutations that can be defined as a 'point' mutation, multiple nucleotide changes are out of range.

This restriction to a single point deviation from the original string is what restricts the math to the number of 'other' possible bases at a given 'point' times the number of possible 'points' that can change.

In the sequence CTAG:

If we desire to create a single point mutation we can change the C, the T, the A or the G. If we change more than one of the four, such as the CT, the TA, CG or even CA, then we have gone beyond the initial condition of only changing a single point.

Your math includes all single point changes, all two point changes, all three point changes and all four point changes less duplications.

In light of the above, the argument appears to revolve around whether or not multiple nucleotide changes are to be included in the calculation or, looked another way, whether the 'initial' string for each iteration can contain mutations from a previous instance.

637 posted on 07/10/2006 7:56:42 AM PDT by b_sharp (Why bother with a tagline? Even they eventually wear out!)
[ Post Reply | Private Reply | To 630 | View Replies]

To: Al Simmons
"With the size of its eyeballs, it couldn't help but have excellent vision," Stevens says.

How big are Blue Whale eyes?

638 posted on 07/10/2006 9:02:00 AM PDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going....)
[ Post Reply | Private Reply | To 1 | View Replies]

To: js1138
If T-Rex was a vegetarian, as Hovind asserts, it was certaintly not a predator.

El Toro is a vegetarian, but the Matador is very wary of him!

639 posted on 07/10/2006 9:03:37 AM PDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going....)
[ Post Reply | Private Reply | To 10 | View Replies]

To: OSHA
Where are the fossils with the high, wide snout without the cheek groves?

Details....

"we KNOW they got to be there; somewhere..."

-- EvoDude

640 posted on 07/10/2006 9:04:43 AM PDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going....)
[ Post Reply | Private Reply | To 14 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 601-620621-640641-660 ... 701 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson