Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,961-9,9809,981-10,00010,001-10,020 ... 22,161-22,177 next last
To: AdmSmith
After Russian air defense hit an Azeri plane over Grozny (yellow circle), it requested emergency landing, 🇷🇺 hasn‘t sent it to Nalchik, Vladikavkaz, or Makhachkala airports (red circles), but to Kazakhstan over the Caspian Sea. 🇷🇺 wanted it crashes into the sea, the wrack is lost.

https://x.com/sumlenny/status/1872179620570955808


9,981 posted on 12/26/2024 1:11:20 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9978 | View Replies]

To: FtrPilot

Putin, Making Russia Great Again.


9,982 posted on 12/26/2024 1:44:16 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9981 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, December 26, 2024

Japan will provide Ukraine with $3 billion in non-lethal assistance generated solely from the proceeds of frozen Russian assets.[40] Ukrainian President Volodymyr Zelensky thanked Japanese Prime Minister Shigeru Ishiba on December 25 for the new aid package and for additional assistance for energy equipment and the construction of shelters in Ukraine. Japan’s transfer of revenues from frozen Russian assets is likely part of the larger G7 Extraordinary Revenue Acceleration (ERA) Loans initiative to send $50 billion worth of profits from frozen Russian assets to support Ukraine’s budgetary, military, and reconstruction assistance throughout 2025.[41]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-26-2024


9,983 posted on 12/27/2024 2:17:33 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9926 | View Replies]

South Korean intelligence confirmed that Ukrainian forces captured a wounded North Korean soldier during operations in Russia’s Kursk Oblast, Yonhap reported on Dec. 27, citing the South Korean National Intelligence Service (NIS).

Ukrainian strikes near Novoivanovka on Dec. 20 inflicted heavy casualties, including the destruction of a North Korean mortar unit, according to Ukraine’s military intelligence (HUR). Despite mounting casualties, Russian officers have ordered North Korean units to maintain their positions. HUR also reported severe logistical challenges for these troops, including a lack of drinking water due to active hostilities.

https://kyivindependent.com/ukraine-reportedly-captures-wounded-north-korean-soldier-in-kursk-oblast-seoul-confirms/


9,984 posted on 12/27/2024 2:21:14 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9983 | View Replies]

1,650 i.e. more than 1.14 Russians and Norks/min


9,985 posted on 12/27/2024 2:23:14 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9960 | View Replies]

To: FtrPilot; PIF
Кремлевская табакерка

Kadyrov to be “sacrificed” to avoid quarreling with Azerbaijan and other partners

Vladimir Putin will be asked to dismiss and “exemplarily punish” Ramzan Kadyrov for the downing of the Azerbaijan Airlines passenger plane in Chechnya . This initiative is being put forward by a group of influential people in the Kremlin. “Kadyrov has created chaos and lawlessness in Chechnya. The poor performance of the air defense, the shots fired at the passenger plane are a consequence of the general disorder. Therefore, he must be removed from his post, forced to pay compensation to the families of the dead passengers. And forget about Ramzan. Forget the whole country. I hope that our Azerbaijani partners will be satisfied with such a sacrifice. Other partners will understand that we are reliable and will not quarrel with us. It seems to me that this is much more important than the fate of Kadyrov alone,” a source in the Presidential Administration close to Sergei Kiriyenko told us. Putin will receive an offer regarding Kadyrov in the near future.

At the same time, the head of Chechnya continues to believe that the plane crash was staged specifically to strike at his positions. And the air defense shot down the plane to harm Ramzan Akhmatovich.

Interlocutors in Kadyrov’s entourage assured us that he is “ready for very serious actions” in the current situation.

https://t.me/kremlin_secrets/5091

9,986 posted on 12/27/2024 2:25:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9981 | View Replies]

Azerbaijan Airlines suspends flights to Russian cities for safety reasons. Starting from December 28, the Azerbaijani airline will cease flights to Sochi, Ufa, Samara, Volgograd, Grozny, Mineralnye Vody, and Makhachkala.

Today, Kazakhstan's Qazaq Air also announced that it would not operate flights to Yekaterinburg.

https://x.com/nexta_tv/status/1872589971720171771

9,987 posted on 12/27/2024 2:33:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9986 | View Replies]

To: FtrPilot
FLTPilot: "All the above is speculation. However, IMHO "battle damage" is more likely than "friendly fire"."

What makes "battle damage" less likely is that these F-18s were not part of the strike mission package, but were used to refuel other aircraft on that mission.
They were, in effect, tankers and so would be kept a safe distance from actual combat.
They landed last, after the others were already aboard.

At least, that's my understanding.

My best guess as to what happened is something like this:

It's 3:00 AM and, after serving all night, a missile operator on Gettysburg needs to take a quick run to the head, so puts his/her system on "automatic" while he/she takes a p*ss.
At that exact moment, the returning F-18s line up for landing and, not seeing the expected IFF signal, Gettysburg on "automatic" mode starts shooting at them.

The operator in the head hears the first missile launch, cuts short the p*ss and races back to his/her station just in the nick of time to hear the Truman CO's very loud W.T.F.!! over the radio and so hits the abort button on the second missile just in time to prevent loss of a second F-18.

IMHO, YRMV

9,988 posted on 12/27/2024 3:26:17 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9974 | View Replies]

To: PIF

Stalin is certainly a close second.


9,989 posted on 12/27/2024 4:17:21 AM PST by blitz128
[ Post Reply | Private Reply | To 9968 | View Replies]

To: BeauBo

Hush Beau, this has nothing to do with sanctions. This is the dear leader recognizing the ecological disaster to the Arctic such a hideous western inspired project would cause. Putin now “free” of evil western influences and greed can now do the “right “ thing

All hail the great strategist and environmentalist😎


9,990 posted on 12/27/2024 4:26:31 AM PST by blitz128
[ Post Reply | Private Reply | To 9980 | View Replies]

To: BeauBo

🚨UKRAINE TO EU: NO MORE RUSSIAN GAS FOR YOU

Ukraine has made it clear: no more Russian gas through its pipelines starting January 1, despite the European Commission’s pleas for energy supplies.

Foreign Ministry spokesman Georgiy Tykhyi confirmed ongoing talks with regional… pic.twitter.com/eH3w6H4HPq— Mario Nawfal (@MarioNawfal) December 27, 2024


9,991 posted on 12/27/2024 4:43:55 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9980 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Shocking Betrayal: Russians Set North Koreans on Fire to Take Credit For The Battle ]

Today [ Dec 26, 8 pm ], there is interesting news from the Kursk direction.

Here, the Russian military, bolstered by North Korean forces, attempted a bold assault to eliminate a critical Ukrainian bridgehead east of the Psel River.

This move set off a series of intense battles and revealed the lengths Russians would go to keep North Korean involvement a secret and take credit for their victories.

The Russian objective, supported by North Korean troops, in this sector of the Kursk salient, was clear: to neutralize the Ukrainian presence east of the Psel River, which posed a significant threat to their operations.

This strategic move aims to neutralize a possible Ukrainian penetration toward Borki and potentially Giri, which Ukrainians have already reached once early in the Kursk offensive. Such a repeated advance would disrupt Russian operations across the Kursk salient, as it would force the redeployment of troops and resources to this sector, away from their efforts in the northwest.

The key position here was Plekhovo, which was defended only by a small Ukrainian contingent, due to its location in the lowlands, and the connected logistical disadvantages, being separated from the rest of the Kursk salient by the Psel River. Exploiting these vulnerabilities, North Korean troops advanced through minefields and reportedly achieved a breakthrough by seizing the village in a highly attritional operation lasting 2 hours.

Geolocated footage from the region confirms the huge columns of North Korean troops advancing to achieve their first success in the area. Despite this, tensions quickly emerged as Russian forces started looking for a way to claim credit for the victory, after initial reports suggested that Russian units only entered Plekhovo after the North Koreans had secured it.

In a brutal twist, reports from Ukrainian intelligence and President Volodymyr Zelensky, indicate that Russian forces started to burn the faces of deceased North Korean soldiers to conceal their identities. This grisly act, confirmed by drone footage, underscores Russia’s effort to obscure the presence of foreign troops on its soil, and avoid acknowledging its reliance on North Korean forces to reclaim its own territory.

Additionally, Ukrainian officials have alleged that North Korean soldiers are being disguised as Russian personnel, highlighting the Kremlin’s desperate attempts to maintain the facade of self-sufficiency.

Following the capture of Plekhovo, Russian forces sought to capitalize on their momentum, and achieve a propaganda victory by advancing toward Oleksandriya and into Ukrainian territory, as Russian State TV was quick to claim a success.

Unfortunately for Russians, Ukrainian Special Operations Forces thwarted this attempt with precision strikes from drones and ambush tactics, forcing the Russian saboteurs to retreat to their own territory, however Ukrainian units decided this was not enough.

They pursued those that went past the border and eliminated both them and the remaining enemy forces, dealing a quick blow to Russian aspirations of further gains and spoiling the desired propaganda effect.

Undeterred, Russian commanders decided to once again rely on North Korean troops, this time deploying them in a high-risk river crossing assault on Kurilovka. Lacking the tactical advantages present at Plekhovo, and forced to storm without cover, the North Korean forces were decimated by Ukrainian drone operators while still trying to cross the river.

The aftermath of the failed assault left the water littered with the bodies of North Korean soldiers, marking another devastating failure for them in the region.

Overall, Russia’s continuing reliance on North Korean troops highlights a pattern of attritional and questionable tactics. Despite their initial success near Plekhovo, the North Koreans have suffered staggering losses, with Ukrainian intelligence estimating over 220 casualties in just a few days of combat. These heavy losses, combined with Russia’s efforts to conceal their presence, paint a grim picture of the exploitation of the North Korean fighters in the war.

The Kremlin’s reliance on North Korean troops underscores the challenges it faces in sustaining its operations. While these troops provide numerical support, their lack of combat experience and the brutal treatment they receive from their Russian counterparts limits their effectiveness.

Ultimately, the deployment of North Korean forces serves as a desperate attempt to bolster Russia’s faltering campaign in Kursk, while exposing the depths of its logistical and strategic vulnerabilities.


9,992 posted on 12/27/2024 4:59:52 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9981 | View Replies]

To: PIF

My Thoughts on AI: Hybrid Warfare - Appeasement or Pragmatism

Hybrid warfare has redefined modern conflicts, blending military force, cyber operations, disinformation, and political manipulation. NATO’s response to Russia’s occupation of Crimea and the ongoing war in Ukraine raises a critical question: Is this strategy pragmatic, or does it reflect a policy of appeasement?

This episode delves into:

The definition and historical evolution of hybrid warfare.
NATO’s adoption of the term and its implications.
Parallels between historical appeasement strategies and NATO’s current challenges.
The risks of Russian expansion into Moldova and Georgia.
The delicate balance between NATO’s pragmatism and deterrence.
Join us as we explore whether NATO’s hybrid warfare strategy ensures long-term stability or emboldens future aggression.

20 min https://www.youtube.com/watch?v=C8P_zEHX4Ps


9,993 posted on 12/27/2024 6:00:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9992 | View Replies]

Finland Detains Russia-linked Oil Tanker Suspected of Cutting Undersea Cable.

The Finnish Border Guard has intercepted and detained the oil tanker Eagle S, suspected of damaging the Estlink 2 submarine power cable that connects Finland and Estonia. The tanker, currently under police control in Finnish waters, is believed to have severed the power line and multiple communication cables in the Gulf of Finland. The Cook Islands-registered vessel, reportedly part of Russia’s shadow eet, was carrying oil from Russia to Egypt when the incident occurred. Finnish authorities suspect the ship deliberately disrupted the cables, as its movements near the area were recorded by the Marinetraffic monitoring service. The Eagle S reportedly slowed signicantly while passing over the cable.
https://defensemirror.com/news/38488/Finland_Detains_Russia_linked_Oil_Tanker_Suspected_of_Cutting_Undersea_Cable


9,994 posted on 12/27/2024 6:10:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9993 | View Replies]

A total of four telecommunications cables running in the Baltic Sea have failed – no impact on services
Submarine cables |In addition to telecommunications cables, the electricity connection Estlink 2 between Finland and Estonia was cut on Christmas Day.

In addition to the electricity transmission cable between Finland and Estonia, there is also a fault in four telecommunications cables. Two of the damaged cables are Elisa’s submarine cables between Helsinki and Tallinn . The third fault is in the state-owned company Cinia’s C-Lion1 submarine cable between Helsinki and Rostock, Germany. The fourth damaged cable is the Chinese-owned Citic Telecom cable between Finland and Estonia.

All the cables failed on Wednesday evening. According to the Finnish Transport and Communications Agency Traficom, Elisa’s cables have been broken and two others have been damaged in other ways. According to Traficom, a preliminary investigation has been launched into the failure of the cables, which will involve international cooperation.

https://www.hs.fi/suomi/art-2000010927039.html


9,995 posted on 12/27/2024 6:19:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9994 | View Replies]

To: BroJoeK

You go with a head break, I’ll go with a dyke fight which is very common in today’s Navy.


9,996 posted on 12/27/2024 6:34:51 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9988 | View Replies]

To: BeauBo; PIF; FtrPilot

Russia losing one platoon per day in repeated failed attempts to cross the Dnipro near Kherson.


9,997 posted on 12/27/2024 8:09:48 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 9695 | View Replies]

To: gleeaikin
Finnish police boarding the oil tanker: text Authorities on the deck of the EAGLE S.

https://www.iltalehti.fi/kotimaa/a/5ebcd428-8ca1-4685-b9f0-0dd55e9a2b1c

9,998 posted on 12/27/2024 8:49:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9994 | View Replies]

To: PIF
Eyes on seabed Russia warfare/spy ship Yantar after sinking of Ursa Major in Mediterranean

https://x.com/CovertShores/status/1871875339070370242

https://www.vesselfinder.com/vessels/details/7524419

https://en.wikipedia.org/wiki/Russian_research_vessel_Yantar

9,999 posted on 12/27/2024 9:14:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9934 | View Replies]

"FOR AS LONG AS IT TAKES"!!


10,000 posted on 12/27/2024 9:49:56 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9991 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,961-9,9809,981-10,00010,001-10,020 ... 22,161-22,177 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson