Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,641-9,6609,661-9,6809,681-9,700 ... 22,061-22,062 next last
To: BeauBo
Explain


To: JonPreston

It seems likely that Speedy may have died.

No one has heard from him, and Free Republic does draw an older crowd.

If that is the case, your posts about him are particularly distasteful and ghoulish.

Personal trolling in any event, is a violation of the rules.

9,639 posted on 12/15/2024 9:16:00 AM PST by BeauBo
**********
To: JonPreston

You are a disrespectful troll, a disgrace to the parents that raised you, for disparaging our fellow Freeper who served his Country honorably, and is no longer with us.

9,649 posted on 12/15/2024 11:18:48 AM PST by BeauBo

9,661 posted on 12/15/2024 4:15:16 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9660 | View Replies]

To: JonPreston

For all the shit you have posted, all the derogatory comments you have made, that is some nerve demanding an apology
GFY


9,662 posted on 12/15/2024 4:42:55 PM PST by blitz128
[ Post Reply | Private Reply | To 9643 | View Replies]

To: blitz128
Claiming a fellow FReeper is dead is no joke.

Maybe to Zeepers, but not us Normals

You can hop on the apology train too.

9,663 posted on 12/15/2024 4:48:43 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9662 | View Replies]

To: FtrPilot; ETCM; AdmSmith; PIF; BeauBo; blitz128; BroJoeK

If Ukraine can regain Crimea in any settlement, then it can renew the Black Sea oil/gas exploration contracts Ukaine signed in 2012 which were cancelled by Russia’s of Crimea in 2014. Quite clearly this was the primary reason for Putin’s actions in both 2014 and 2022, as well as significant for his Syria efforts and choices. The BIG QUESTION now is how Trump will judge future impacts for the US and his POLITICAL future given his US goal of drill, baby, drill? Will improving Ukraine’s prospects for Crimea petroleum, and Turkey’s interest in the pipeline income cause Trump to support Ukraine, or might Trump have some other thoughts/plans regarding relations with Turkey, like Crimea for Turkey? I know Trump family members have tried in the past to work out big business deals with Erdogan family members.


9,664 posted on 12/15/2024 5:06:25 PM PST by gleeaikin (in Question authority as you provide links)
[ Post Reply | Private Reply | To 9648 | View Replies]

To: JonPreston

There is nothing normal about your hypocritical ass, nice try


9,665 posted on 12/15/2024 5:41:47 PM PST by blitz128
[ Post Reply | Private Reply | To 9663 | View Replies]

To: blitz128

jeez, you’re mad at the wrong guy. It’s BeauBo who said Our Speedy is gone, not me. Do you think he’s gone too?


9,666 posted on 12/15/2024 6:00:39 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9665 | View Replies]

To: JonPreston

“Our speedy “, the one you insulted repeatedly, come to this post with your memes, and juvenile comments.

I have no idea about speedy’s situation, but take your fake moral outrage and shove it.

Day 1


9,667 posted on 12/15/2024 6:05:27 PM PST by blitz128
[ Post Reply | Private Reply | To 9666 | View Replies]

To: blitz128
I have no idea about speedy’s situation

See BeauBo for details. He has our FRiend iced and boxed.

9,668 posted on 12/15/2024 6:13:33 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9667 | View Replies]

To: blitz128

Thank you.


9,669 posted on 12/15/2024 6:39:12 PM PST by Mr. Lucky
[ Post Reply | Private Reply | To 9667 | View Replies]

To: blitz128; PIF; BeauBo; FtrPilot

“The reports of my death are greatly exaggerated”

My friends, I’m alive and well. Family is even going on a ski trip to Montana after Christmas. I’ll be out on the slopes, knees permitting. So all is well.

Some of you have expressed your concerns and I appreciate that (blitz128!).

But I’ve decided to move on from FR. I don’t fit in here anymore. Administration allows RuZZians to pollute this site. Plus I’ve come to realize I’m a Reagan Republican and not a Trump Republican. There isn’t much tolerance of MAGA dissent here.

I’ll log off again after this post. I do not check mail and only visit this site occasionally. I’m following the war but just read my own sites at my leisure.

Merry Christmas to everyone.

PS, the RuZZians are dying by the thousands every month. Celebrate. Sing and Dance!


9,670 posted on 12/15/2024 7:56:52 PM PST by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 9667 | View Replies]

To: SpeedyInTexas

Merry Christmas Brother Speedy!

Thanks for checking in, and giving us a howdy. A lot of us were worried about you.

RuZZia is punching itself out. Assad has been deposed, Cuba is collapsing and the Ruble Death Watch is underway. Ruskii Mir is on the ropes.

Please come join us for the festivities as ruZZian losses occur. Don’t let those lying commie bastards get you down - you are welcome here.


9,671 posted on 12/16/2024 3:03:51 AM PST by BeauBo
[ Post Reply | Private Reply | To 9670 | View Replies]

To: FtrPilot
On proposed Qatar-Turkey Gas Pipeline: "Pipeline construction and on-going revenue will help the Turkish economy..."

There are several pipelines already existing or proposed to transport gas & oil from the Middle East & Caspian Sea region through Turkey to Europe.
These have the potential to eliminate Europe's dependence on Russian gas & oil.

Existing Turkish gas and oil pipelines:

Existing and proposed gas pipelines through Turkey:

9,672 posted on 12/16/2024 3:11:06 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9636 | View Replies]

To: BeauBo
Merry Christmas Brother Speedy!

Thanks for checking in, and giving us a howdy

Isn't this what I've been saying for 45 days? Speedy is a #NeverTrump Neocon who is devastated by DJT's 3rd Presidential victory. And here you were, BeauBo, trying to shut down my 1st Amendment by saying Speedy had shuffled off this mortal coil. What a Dimwit. Same to you, Mr Low IQ


9,673 posted on 12/16/2024 3:18:52 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9671 | View Replies]

To: FtrPilot; ETCM; BeauBo
Here is an older picture of existing Middle East gas (green) and oil (gold) pipelines:


9,674 posted on 12/16/2024 3:39:44 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9672 | View Replies]

To: SpeedyInTexas; Allegra; aMorePerfectUnion; kiryandil; tennmountainman; bimboeruption; mass55th; ...
"PS, the RuZZians are dying by the thousands every month. Celebrate. Sing and Dance!"

Good riddance you sick, death-loving, leftist ghoul.

9,675 posted on 12/16/2024 3:41:48 AM PST by Rocco DiPippo (Either the Deep State destroys America or we destroy the Deep State. -Donald Trump)
[ Post Reply | Private Reply | To 9670 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ ATACMS Wipe Out a Massive Russian Ammo Depot ]


Today [ Dec 15, 8 pm ], there are a lot of interesting updates from the Russian Federation.

As Ukrainians received approval to use long-range supersonic ATACMS missiles, they successfully used them to hit targets deep in the Russian rear.

Seeing the devastating effect of their previous ATACMS strikes on the Russian war effort, the Ukrainians launched the 2nd wave of strikes, further straining the Russian war effort.

The 1st target of Ukraine’s strikes was a strategically important airbase in the city of Taganrog. Ukrainian forces employed 6 ATACMS missiles in the attack, inflicting significant damage on the aircraft repair plant located near the airbase. This destruction will hinder Russia’s ability to maintain and repair critical strategic aircraft, such as A-50 airborne early warning and control planes, as well as other military aircraft.

Consequently, the Russian Air Force will face reduced operational capacity, with fewer combat sorties and diminished airstrike effectiveness, due to limited airborne radar coverage and bases to facilitate such strikes.

The 2nd target was the town of Markyne, where Ukrainian ATACMS strikes destroyed a large ammunition depot. The resulting explosion was visible for kilometers and audible even farther away. The strikes on Mariupol bases, specifically along with the inflicted destruction in Markyne, will significantly disrupt Russian ground force logistics.

Moreover, several days prior to that, Ukrainians also targeted a train depot in the Bryansk region, destroying 2 locomotives critical for Russian supply operations. Since most Russian logistics rely on railways, such strikes cause immediate and significant equipment shortages and delays in frontline resupply efforts.

The success of Ukraine’s recent ATACMS strikes lies in the missile’s immense destructive power. Weighing 1,600 kilograms, the ATACMS carries a warhead with over 500kg of explosive material, making it far more destructive than most other missiles, including standard HIMARS rockets.

This capability allows Ukraine to severely damage critical Russian infrastructure that directly impacts the war effort, such as command centers, military production facilities, power plants, metallurgical plants, oil refineries, and military repair facilities.

Striking such targets not only weakens Russia’s military capacity, but also deals a significant blow to its economic stability, slowly altering the course of the war.

Interestingly, the Ukrainians also utilized Palyanitsa drones to complement the ATACMS strikes. To maximize the effectiveness of these strikes on Russian critical infrastructure, drones were deployed ahead of the missiles to probe and exhaust Russian air defenses by forcing them to expend ammunition. This tactic overextends Russian systems, including their advanced S-400, which can only track up to 36 targets at once.

As a result, large drone swarms preceding ATACMS strikes overwhelm Russian operators, forcing them to make high-pressure decisions about which aerial threats to prioritize. This chaos enables ATACMS missiles to bypass air defenses with a much higher probability of successfully hitting their intended targets.

This strategy enabled the Ukrainians to target the oil depot in Bryansk with several ATACMS missiles. The resulting explosions were so massive that they were heard and seen well beyond the city, indicating severe damage. Destroying Russian oil depots deals a critical blow to their war efforts, causing short-term fuel shortages.

Such shortages delay the deployment of certain units to the front or force them to halt ongoing attacks while awaiting refueling. This disruption could paralyze or pacify specific sections of the front, reducing fire support and troop mobility in armored vehicles, and creating opportunities for Ukrainian counterattacks.

Overall, the 2nd Ukrainian wave of ATACMS precision strikes deep behind Russian lines inflicted severe damage on Russian frontline logistics, together with a short-term hampering of aerial operations on the front. These strikes will enable the Ukrainians to reduce the pressure on their frontline units, as the Russian forces suffer from a short-term shortage of ammunition.

Simultaneously, the Russian government will be forced to redirect funds from the war effort to repair and rebuild damaged and destroyed critical infrastructure from Ukrainian strikes, forcing a slowdown of offensive operations.


9,676 posted on 12/16/2024 3:42:12 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9671 | View Replies]

Zelensky is a delusional coke head that is trying to get us all killed! https://t.co/nD6O3eerdL— Alex Jones (@RealAlexJones) December 16, 2024


9,677 posted on 12/16/2024 4:10:36 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9675 | View Replies]

To: SpeedyInTexas

Thanks again - please check your mail at least once.

Merry Christmas and a Happy New Year to you and your family.


9,678 posted on 12/16/2024 4:22:01 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9670 | View Replies]

To: JonPreston

When NATO illegally attacked Serbia, it killed thousands of innocent people, it bombed Civilian infrastructure and devastated the Economy.

It had No mandate from the UN

No NATO member was attacked by Serbia.

It was all completely illegal, The "Defensive Alliance" indeed.

pic.twitter.com/s9cyRk5hzj— Chay Bowes (@BowesChay) December 15, 2024


9,679 posted on 12/16/2024 4:23:54 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9677 | View Replies]

To: gleeaikin; BeauBo; PIF
North Korean forces are reportedly facing expected struggles with high casualties and poor communication with Russian forces in Kursk Oblast, likely disrupting coordination between North Korean and Russian personnel and undermining Russian military operations. Ukraine's Main Military Intelligence Directorate (GUR) reported on December 14 that North Korean forces operating in Kursk Oblast recently fired at Chechen “Akhmat” Spetsnaz battalion vehicles and killed eight Chechen personnel in a friendly fire incident, likely due to the language barrier between the Russian and North Korean forces.[11] The GUR noted that the language barrier also hinders effective combat coordination between Russian and North Korean forces.[12] The GUR reported that a contingent consisting of Russian and North Korean servicemen in Kursk Oblast lost 200 personnel as of December 14 and that Ukrainian drones swarmed a North Korean position, which is consistent with recent reports of North Korean forces engaging in attritional infantry assaults.[13] The poor integration and ongoing communication problems between Russian and North Korean forces will likely continue to cause friction in Russian military operations in Kursk Oblast in the near term.

Russian sources continue to complain about the Russian military's insufficient training system and inept military instructors. A Russian milblogger and former Storm-Z instructor claimed that the Russian military training system continues to rely upon military instructors who either have no direct combat experience or outdated military experience.[79] The milblogger claimed that Russian military instructors are not adapting their lessons to the changing conduct of war, but are instead only drawing from their “irrelevant” and “insufficient” combat experience. Another Russian milblogger similarly complained that Russian soldiers who had previously served in private military companies (PMCs) often struggle to adjust to the command culture of the regular Russian military, as the former PMC fighters believe they are superior to other soldiers and their commanding officers.[80] The milbloggers also claimed that most Russian junior officers only receive tactical military training and no leadership training.[81]

A Russian insider source claimed on December 15 that Russian Foreign Intelligence Service (SVR) Director Sergei Naryshkin may have fallen out of favor with Russian President Vladimir Putin following the Assad regime's collapse since Putin reportedly recently rescinded a decree to present Naryshkin with a state award.[22]
https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-15-2024

9,680 posted on 12/16/2024 4:28:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9605 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,641-9,6609,661-9,6809,681-9,700 ... 22,061-22,062 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson