Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,101-9,1209,121-9,1409,141-9,160 ... 20,061-20,064 next last
To: FtrPilot

“President Trump is going to drive the price of oil down. ”

There are a lot of variables, but if anyone can do it, he can. I expect that he likely will, even though the lag time for the effects of some actions will be years.

Some actions, like sanctions on Iran, Russia or Venezuela, could drive prices up in the short term.


9,121 posted on 12/04/2024 7:26:29 PM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9120 | View Replies]

To: FtrPilot; BeauBo; PIF; blitz128; AdmSmith; marcusmaximus; BroJoeK; Monterrosa-24; ...

The price of oil is already down a fair bit. I was quite happy the day before Thanksgiving to see cheap gas on the DelMarVa Peninsula. I paid $2.83/9 in Virginia (the best I saw), and also a lot of $2.95/9 to $3.09/9 at Royal Farms stops and other lower priced companies in VA and MD. Last spring it looked like big oil was being cautious about getting leases or starting work on them. Some may have been badly burned when during the Trump years gas was selling near $2.00, and the price of oil dropped really low and all the storage spaces and tankers were full up. Pumpers were so desperate to find storage space there was one day when they PAID people to take delivery of their oil. A number stopped pumping and drilling. It was said then that a number of newer areas needed $80 oil to make a good profit, so some have been cautious about starting up again.

Does anyone know what the profit point for oil prices is in places like N Dakota, or PA for fracking oil? Also for some of our other important producing areas. Or even for Tar Sands oil production? Trump will need a really smart Oil Czar to find the point that provides the most joy for oil producers and oil consumers. Not only the US market is concerned, but major parts of the rest of the world, and with the wars and struggles pricing will be really touchy. He will need expert advise on just how much Drill, Drill, Drill, will satisfy his voters and financial supporters.

I am also concerned about Trump’s current pick for Secretary of Defense. Does he mean NO women in the military, except as office workers far removed from combat, or only no hand to hand/trench fighting women. Apparently, even the Norks have women fighters. Does anyone know how many, what % of
drone operators in Ukraine are women? Have some women made good snipers? Certainly they have a lot of patience, and probably deal better with lack of sleep. We don’t hear about Russian women in the military. What is their view on women soldiers? Or is Putin too eager to have them all reproducing as fast as they can? Watching Foyle’s War it is interesting to see how England was dealing with man shortages on the home front by using women workers. What current US use of women is working, and what use of women here needs rethinking or change? I have not seen any sign that the current candidate has done a lot of this important thinking or consulting.


9,122 posted on 12/04/2024 10:39:45 PM PST by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 9120 | View Replies]

To: BeauBo
“Russians’ cash savings (in rubles) have reached an all-time low of 15.9 trillion rubles ($152.15 billion)

and about 94 billion in foreign currency in dollar equivalent.
https://russiacalling.ru/news/2024-12-04-h-ru/

With 143 M Russians this is on average about $1,000 in cash saving in Rubbles and $ 660 in foreign currency. It's very little, and given that the total also includes the money of the oligarchs, in reality it's hardly anything for Ivan and Ivanka.

9,123 posted on 12/05/2024 12:16:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9118 | View Replies]

Russian Offensive Campaign Assessment, December 4, 2024

Armenian Prime Minister Nikol Pashinyan announced on December 4 that Armenia has effectively reached “the point of no return” in its ties with the Russian-led Collective Security Treaty Organization (CSTO).[12] Pashinyan criticized CSTO allies for failing to respond to Azerbaijan's encroachment on Armenia's internationally recognized territory in 2021 and 2022 - likely referring to encroachments into Syunik and Gegharkunik provinces - despite prior assurances that any violation of Armenia's territorial integrity was a “red line” for the CSTO.[13] Pashinyan stated that the CSTO lacks credibility because it does not have a clearly defined zone of responsibility in Armenia — despite Armenia still formally being a member state - and emphasized that Armenia's issues with the CSTO are not necessarily related to the Nagorno-Karabakh conflict. Pashinyan indicated that Armenia no longer participates in CSTO activities or policymaking. ISW continues to observe souring Armenian-Russian bilateral relations and assesses that a formal Armenian withdrawal from the CSTO would serve as another blow to Russian power projection across the countries that the Soviet Union once colonized.[14]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-4-2024

9,124 posted on 12/05/2024 12:36:17 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9059 | View Replies]




9,125 posted on 12/05/2024 12:39:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8941 | View Replies]

1 580, i.e. more than 1.09 Russians and NorKs/min, and more than twice the average. The losses of vehicles and fuel tanks are more than 3 times the average


9,126 posted on 12/05/2024 12:49:22 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9062 | View Replies]

To: gleeaikin

The women in combat argument is a lightning rod for the left. There is a difference between can and should when it comes to frontline combat roles.
The army tried a gender neutral physical standards approach and it did not work.
Physical standards will always be an issue. In the Air Force where I served for almost 40 years the difference in standards based on gender(sex) were stark. As a 50 year old my standards were higher than an 18 year old woman. And then there is age, the standards for both male and female get lower as one gets older.
In principle I have argued like being a fire fighter or police officer there should be minimum standards that are required to fulfill the job you hold, but the reality is not that, simply because there is a difference between sexes in general and as one ages.
Frontline combat is different from being a mechanic, office worker, pilot, artillery, medical……
The actual number of frontline combat soldiers is relatively small compared to the overall numbers serving in the military.

With that said do I think there are women who can be frontline combat soldiers, yes, do I think they are necessary as some suggest, no.

There are many positions that may result in being under fire and result in being in combat operations because of the fluid nature of battle and the nature of insurgent operations we have been involved in, but in general putting women in frontline combat roles is unnecessary.

I will add two more things, when I was in Iraq I was with an AFSOC unit which meant I was behind the wire and no direct combat role, but in one occasion I did have to go outside the wire. At the time I was in my late 40s and not in bad shape and suited up in full combat gear and load out was challenging and gave me a new perspective to those who did this day in and day out.

Second, I understand those women who want to do this, but those who push this as if the only reason its not common is some kind of sexism, need to suit up and see what it is like. There is a reason there are no trans men breaking records in male sports and trans women are breaking all kinds of female sport records
Just my two cents


9,127 posted on 12/05/2024 4:37:17 AM PST by blitz128
[ Post Reply | Private Reply | To 9122 | View Replies]

To: JonPreston; PIF; gleeaikin
JonPreston: "Ex-Polish gov't official claims up to 50% of financial aid given to Ukraine has been embezzled.
Former Deputy Minister Piotr Kulpa accused US aid programs of giving massive bonuses to Ukrainian officials."

Here are two news reports on this item:

So, first, Piotr Kulpa was Poland's Deputy Prime Minister from 2004 to 2005.
Since then, he has worked as a consultant advising on EU projects, especially in Ukraine.
So it's possible he has first-hand knowledge of what he reports.

On the other hand, corruption is criminal, even in Ukraine, and so we have to wonder how much of it did Kulpa actually witness over nearly 20 years but failed to report to authorities?

Indeed, Volodymyr Zelensky ran for Ukraine's president in 2019 on a good-government anti-corruption platform and since Zelensky's election there has been a steady stream of reports on corrupt Ukrainians tried and convicted for their crimes.

  1. Ukraine purges officials, governors in biggest shakeup of war
    WAR IN UKRAINE Europe
    Ukraine dismissed more than a dozen senior officials including governors of several major battlefield provinces on Tuesday in the biggest shake-up of its wartime leadership since Russia's invasion last year.
    Issued on: 24/01/2023 - 10:24, 3 min By: NEWS WIRES

  2. Volodymyr Zelenskyy's other challenge? Fighting persistent Ukraine corruption
    High-ranking government officials Oleh Tatarov, Andriy Yermak have denied bribery allegations
    Stephen Grey, Dan Peleschuk · Thomson Reuters · Posted: Sep 20, 2023 9:05 AM EDT | Last Updated: September 20, 2023

  3. Million Dollar Girl: Cottage, Porsche, and Beauty Salon for Deputy Prosecutor General Verbytsky's Girlfriend
    Radio Svoboda June 10, 2024, 9:18 PM Georgy Shabaev
One result has been a large improvement in Ukraine's rankings in the Transparency International Corruption Perceptions Index -- up from #152 in 2003 to #104 today.

In meantime, the US has fallen from #16 in 1995 to #25 today, arguably, under the influence of corrupt Democrat administrations like the Clintons, Obamas and Bidens.

A long list of US government audit reports did not find corruption in US aid to Ukraine.

Transparency International's 2023 Corruption Perception Index
Shades of red = more corrupt, shades of green = less corrupt:


9,128 posted on 12/05/2024 5:11:54 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9068 | View Replies]

To: BeauBo

Two reports today: one from last evening at 8pm and the second from today at 6am

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian in Shock! 2 Ukrainian Marines Wipe Out 20 Russian Soldiers! ]


Today [ Dec 04, 8 pm ], there are a lot of updates from the Kursk direction.

Here, faced with devastating losses of armored vehicles, Russian forces resorted to mass infantry assaults, relying on sheer numbers to breach Ukrainian defenses.

This shift in tactics led to a dramatic confrontation, where two Ukrainian soldiers on a small strong point held their ground against an overwhelming force of 20 Russian troops in a fierce battle.

The main Russian offensive near Tolstyi Lug follows the local highway, aiming to breach Ukrainian defenses in two directions: east toward Novoivanovka and south toward Nizhnii Klin. This tactical shift comes after repeated failures to cross the Snagost River, where challenging terrain and fortified Ukrainian fire positions on the eastern bank, have thwarted their advances.

Now, the Russian strategy focuses on bypassing the river from the north with concentrated frontal assaults designed to divide Ukrainian forces in the Kursk region.

However, the Ukrainians have established formidable multi-layered defensive positions in the region, utilizing extensively mined fields and repurposing abandoned Russian fortifications, once used to secure the international border. In combination with the Snagost River to the south and Novoivanovka to the north, this creates a narrow corridor, with limited space for the Russians to maneuver under strict Ukrainian fire control.

After suffering the destruction of multiple waves of armored vehicles and exhausting their reserves, the Russians were left with no choice but to revert to their notorious “meat wave” tactic, sending hundreds of soldiers to storm Ukrainian lines on foot.

The Institute for the Study of War, citing Ukrainian officers in the Kursk direction, reported that Russian forces have largely abandoned the use of heavy equipment, after suffering devastating losses from Ukrainian strikes. Instead, they now rely on infantry assaults, typically in small teams of three to five soldiers.

Frontline troops have corroborated this, describing the battles as highly active and intense, dominated by infantry engagements. Dramatic footage from the Tolstyi Lug area further illustrates the ferocity of these clashes.

Drone operators of the 36th Marine Brigade of Ukraine released a geolocated video, showcasing the heroism of their soldiers responsible for the defense of this sector and the high level of coordination between units on the ground and in the skies above.

The first image reveals a group of nearly 10 Russian stormtroopers infiltrating a Ukrainian trench, while another similarly sized unit advances openly across the fields. Fortunately, both groups are spotted simultaneously by a reconnaissance drone and two vigilant Ukrainian marines.

Acting with remarkable speed and precision, the marines quickly take their firing positions, unleashing a fierce counterattack with small arms fire and grenades, effectively halting the enemy assault in its tracks.

The Russians, under heavy fire, were forced to take cover in nearby bushes and return fire from their positions. Recognizing the dire situation faced by their two outnumbered comrades, Ukrainian drone operators acted swiftly, calling in artillery support. The first shell landed near the Russian positions, wounding several and forcing them to retreat further from the embattled marines.

Moments later, additional shells struck the trench where the initial Russian group had gathered, inflicting devastating casualties. The harrowing footage concludes with grim images of Russian stormtroopers lying dead in the fields and trenches - stark evidence of yet another failed assault in this direction.

Overall, the shift from mechanized assaults to massed infantry attacks, not only highlights the depletion of their armored capabilities, but also reflects a broader failure to adapt effectively to Ukraine’s layered defenses and precision strikes. The featured battle, epitomized by the heroic stand of 2 Ukrainian soldiers against overwhelming odds, demonstrates Ukraine’s ability to leverage tactical setting and coordination to neutralize numerically superior forces.

These developments suggest a growing disparity in the strategic calculus, where Russian forces are increasingly sacrificing manpower without meaningful gains, further weakening their capacity to sustain prolonged offensives.


9,129 posted on 12/05/2024 5:34:52 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9121 | View Replies]

To: AdmSmith

“The losses of vehicles and fuel tanks are more than 3 times the average”

I think they are running low on tanks and Infantry Fighting Vehicles (BMP, in Russian), and are using more vulnerable vehicles to get around during ground combat. Vehicle losses are up, and tank losses (which includes BMPs, in the Ukrainian count - something lost in translation), are down.


9,130 posted on 12/05/2024 6:05:28 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9126 | View Replies]

To: PIF; AdmSmith

“Overall, the shift from mechanized assaults to massed infantry attacks, not only highlights the depletion of their armored capabilities, but also reflects a broader failure to adapt effectively to Ukraine’s layered defenses and precision strikes.”

This is a better analysis of the drop in Russian Armor losses and the rise in human casualties. Part of it no doubt, is the rise in drone use.


9,131 posted on 12/05/2024 6:18:26 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9129 | View Replies]

To: AdmSmith

“Russians’ cash savings (in rubles) have reached an all-time low of 15.9 trillion rubles ($152.15 billion). …and about 94 billion in foreign currency in dollar equivalent.”

That roughly 5-3 ratio of rubles to foreign currency, shows a big problem with the ruble. Lack of confidence and/or a practical need for other currencies, that can do what the ruble cannot.

Russian people are voting with their savings, against the ruble.


9,132 posted on 12/05/2024 6:31:47 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9123 | View Replies]

To: blitz128; gleeaikin

One of the requirements in close quarters battle, is to carry or drag wounded men away. Few women can (damn few) when both are loaded with gear.

Many of the people we fight can be expected to gang rape female prisoners.


9,133 posted on 12/05/2024 6:40:17 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9127 | View Replies]

To: BeauBo

Many of the people we fight can be expected to gang rape female prisoners. to death.


9,134 posted on 12/05/2024 7:09:40 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9133 | View Replies]

To: BeauBo

There are few men who can do this, even fewer women can. What is dangerous is when the fudge the number for the sake of DEI and they can say see women can as if the only thing holding them back is sexism.

People will die because of it.

As I talked about before, we had men who could pass women’s standards for PT, but were kicked out because they couldn’t pass the men’s, is that sexist ?


9,135 posted on 12/05/2024 7:11:02 AM PST by blitz128
[ Post Reply | Private Reply | To 9133 | View Replies]

To: BroJoeK
Excuse me, I'm returning unopened. I did not order this Neocon Swill


9,136 posted on 12/05/2024 8:20:41 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9128 | View Replies]

To: gleeaikin
"I am also concerned about Trump’s current pick for Secretary of Defense."

Joni Ernst supported and funded all the nonsense on the left. She wants to destroy the person on the right. Why is that? pic.twitter.com/dkwsoTZtTS— Sean Davis (@seanmdav) December 5, 2024


9,137 posted on 12/05/2024 8:34:26 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9122 | View Replies]

To: JonPreston

Joni wants that job. Bitch.


9,138 posted on 12/05/2024 8:45:04 AM PST by MayflowerMadam (It's hard not to celebrate the fall of bad people. - Bongino)
[ Post Reply | Private Reply | To 9137 | View Replies]

To: MayflowerMadam
100%

U.S. FREEZES UKRAINE AID: WHAT THIS MEANS FOR TRUMP AND THE WORLD

Speaker Johnson’s decision to block $24 billion in Ukraine aid is a sharp pivot from Biden’s approach, signaling a transition in power and priorities.

The message? “Hold tight, Trump’s in charge now.”

For… https://t.co/oDZMKsPChy pic.twitter.com/sZvQEizY2r— Mario Nawfal (@MarioNawfal) December 4, 2024


9,139 posted on 12/05/2024 9:06:40 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9138 | View Replies]

To: ETCM

Kremlin snuff box, 12/05/24
https://t.me/s/kremlin_secrets

“Cunning bug” Erdogan did not listen to Putin. What is going on in Syria and when will we punish Turkey for this?

The loss of the Syrian city of Hama [ https://t.me/milinfolive/136753 ] means Turkish President Erdogan has no intention of stopping militants linked to him. And “finally turns into an enemy of Russia”. This opinion was expressed by our source in the Kremlin.

“Unfortunately, Erdogan did not hear what Vladimir Vladimirovich told him during a recent conversation [ https://t.me/kremlin_secrets/4987 ]. The situation in Syria is rapidly deteriorating, and Türkiye is directly involved in this. Well, there will be an answer. “Very serious,” the channel’s interlocutor promised.

A source in the Ministry of Defense explained Erdogan’s behavior this way:
“It seems that for some reason our still respected Turkish partner decided that Russia does not have enough forces to solve all the problems - in Ukraine, Syria, the Caucasus, Crimea and the Kursk region, as well as in terms of preparing for a serious clash with NATO ( I hope it won’t happen, but we are preparing as much as possible ). We have enough strength! And Erdogan will regret what he did.”

True, not all military personnel share this opinion.

“The forces may indeed not be enough, which is why, if we send additional troops to Syria, it will be later [ https://t.me/kremlin_secrets/4990 ]. Erdogan is a cunning bug, he found where to hit us. But I think we will really punish him. Just not right now. Now, you see for yourself in Syria, there may be problems,” says an interlocutor surrounded by Valery Gerasimov.

We asked how to prepare for a truly effective response. The source said:
“Stop the circus within the country, in particular, to calm down Kadyrov and others like him ( the military, we recall, expressed dissatisfaction with the Chechen leader telling when the SVO might end - ed. [ https://t.me/kremlin_secrets/4993 ] ). Make sure that society knows: we have a war, it is global and will affect everyone or almost everyone. Replenish the army. And so on. The recipes are known, there is nothing new in them.”


9,140 posted on 12/05/2024 9:22:19 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9011 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,101-9,1209,121-9,1409,141-9,160 ... 20,061-20,064 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson