Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,921-8,9408,941-8,9608,961-8,980 ... 18,661-18,673 next last

8,941 posted on 12/01/2024 2:18:01 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8884 | View Replies]

To: ETCM; PIF
Кремлевская табакерка

After Syria, Erdogan may strike us in Crimea

A source in the Ministry of Defense expressed such concerns. “After what happened in Aleppo, in Syria in general because of the betrayal of the Turks, you can expect anything from Erdogan. There is reason to believe that serious problems will be organized in Crimea,” he said.

Help to the enemy could be the guidance of missiles and drones on important objects on the peninsula, intelligence information and even, perhaps, “some actions related to weapons.” Although there is no confirmation of information about weapons yet.

The threat from Turkey was also confirmed by an interlocutor in the Ministry of Foreign Affairs. “Erdogan continues to hint that he wants control over Crimea . And he is transmitting signals that it will be “very difficult to live” there. This is actually blackmail, I hope we will find a worthy response to it,” the source said with irritation.

It should be noted that last year, Erdogan, demanding Crimea for himself, already threatened: if the peninsula is not handed over to him, it will be seriously bombed. After that, the enemy launched a series of destructive attacks on Crimea.

Therefore, the current threats should be taken seriously. Both by the military, and by politicians (something needs to be done about the Turkish problem!), and by all residents of Crimea and Sevastopol.

https://t.me/kremlin_secrets/4974

Russia is increasingly unable to help Syria's regime counter an offensive by Syrian rebels due to Moscow's military forces being tied down in Ukraine, Turkish security sources have said.

Earlier this week, Syrian opposition fighters led by the militant group Hay’at Tahrir al-Sham (HTS) launched a shock offensive against forces fighting for Bashar al-Assad’s regime, yesterday capturing the major city of Aleppo in rapid advances that have surprised many.

According to the outlet Middle East Eye, unnamed Turkish security sources confirmed to it that Russia has been slow to respond to the Syrian rebel offensive exactly due to the relocation of most of its aerial assets to Ukraine.

Consequently, it left behind a much smaller force in Syria, rendering it largely insufficient to properly counter the operation. Although Russia's air force did target some locations in Idlib and other areas of northwestern Syria in recent days, those efforts proved ineffective in halting or limiting the rebel offensive.

Highlighting satellite images from Russia's Hmeimim airbase in Syria's Latakia province showing a significant reduction in its air force presence compared to 2019, Ozkizilcik revealed that “reports from local sources on air activity show that Russia is primarily using older fighter jet models”.

https://www.middleeastmonitor.com/20241201-russia-unable-to-help-assad-regime-counter-syria-rebel-offensive-due-to-being-militarily-tied-down-in-ukraine-sources-say/

Syrian rebels captured Russian-made Pantsir air defence system in Aleppo.



https://x.com/clashreport/status/1863127367863910805

8,942 posted on 12/01/2024 2:37:45 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8937 | View Replies]

1,730, i.e. more than 1.20 Russians and NorKs/min


8,943 posted on 12/01/2024 2:58:01 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8905 | View Replies]

At least 5 154 Russian officers have been eliminated in the Russian invasion of Ukraine since 24 February 2022.
Weekly update: +37 newly registered.
This figure is confirmed by Russian obituaries, graves and memorial plaques. Sources can be found in our spreadsheet.

https://x.com/KilledInUkraine/status/1863172096538407031

8,944 posted on 12/01/2024 3:00:21 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8943 | View Replies]

To: AdmSmith
S-300 air defense system of AFU 🤩 🇺🇦

https://x.com/Maks_NAFO_FELLA/status/1863204168413966817

Converted to be used as a surface-to-surface SRBM.


8,945 posted on 12/01/2024 5:53:45 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8944 | View Replies]

To: PIF
Around Chasiv Yar, every russian is getting a drone for the holidays

https://x.com/NAFORaccoon/status/1862836103054553535


8,946 posted on 12/01/2024 6:01:23 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8945 | View Replies]

To: BeauBo
🔥A massive fire has broken out in #Yekaterinburg, Russia.

The fire has engulfed a 1,500 square meter building.

Local residents are complaining of acrid smoke.🔥

https://x.com/UaCoins/status/1863159003817156811

Yekaterinburg, Russia on Google Maps


8,947 posted on 12/01/2024 6:06:52 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8946 | View Replies]

To: PIF
18+⚠ Having trouble falling asleep?

Instead of just counting to 100 🐏, we suggest counting to -100 occupiers.💀

The best shots of our pilots' work over the past few weeks.

https://x.com/UaCoins/status/1862969573349147037


8,948 posted on 12/01/2024 6:16:52 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8947 | View Replies]

To: AdmSmith

1 USD = 107.734 RUB Dec 1, 2024, 14:25 UTC

https://www.xe.com/currencycharts/?from=USD&to=RUB&view=12H


8,949 posted on 12/01/2024 6:28:02 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8938 | View Replies]

To: FtrPilot
🤣Two 🇷🇺 Russian elite "special" forces were captured by the 🇺🇦 Ukrainian 137th Marine Battalion.

They are grateful to them for saving their lives.

Their callsign are «Shorty Z» and «Oldy V»

https://x.com/GloOouD/status/1862979276049445215


8,950 posted on 12/01/2024 6:28:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8948 | View Replies]

To: AdmSmith

Poland will wipe the floor with them if they are that stupid; not to mention the use of pre-postioned US military stores in Lithuania.


8,951 posted on 12/01/2024 6:31:41 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8940 | View Replies]

To: PIF
Ukraine has successfully tested the Hitchhiker, a cutting-edge drone interceptor developed by 2 American companies.

With a speed of 450km/h & range of 200km, it's designed to counter strike drones such as Iranian/Russian made Shahed drones which daily attack Ukraine.

https://x.com/GlasnostGone/status/1863139228168663199

...a speed of 450km/h & range of 200km...

I would like to know:

Cost
Terminal Guidance
Kill mechanism

8,952 posted on 12/01/2024 6:39:10 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8951 | View Replies]

To: AdmSmith

Aleppo Has Fallen, Assad’s Forces Regrouping As Rebels Blitz South
The rebel forces’ blitz south is impressive, but holding all that territory will be put to the test if a robust response materializes. ( posted 9 hrs ago )
https://www.twz.com/news-features/aleppo-has-fallen-assads-forces-regrouping-as-rebels-blitz-south


Rebel Forces Enter Syria’s Second Largest City Of Aleppo
A surprise offensive launched against the Assad regime earlier this week has made startling progress in northwest Syria. ( 11/30/24 )
https://www.twz.com/news-features/rebel-forces-enter-syrias-second-largest-city-of-aleppo


8,953 posted on 12/01/2024 6:39:25 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8942 | View Replies]

To: PIF
The ruzzians have scattered leaving aircraft, armored vehicles (including tanks), radars, weapons and ammo.

When the going gets tough, the ruzzians prove their worth.

8,954 posted on 12/01/2024 6:41:51 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8953 | View Replies]

To: FtrPilot

Two reports today: Kursk from last evening at 8pm, and the second from Donetsk today at 6am


Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians in Shock. Hundreds Dead in Devastating Strikes! ]


Today [ Nov 30, 8 pm ], there are a lot of updates from the Kursk direction.

Here, in a desperate bid to break the stalemate and finally reclaim Kursk, Russian forces began redeploying many thousands of additional Russian and North Korean troops, tanks, and armored vehicles to the region.

However, Ukrainian forces used this chance to track down their movement, exposed dozens of Russian warehouses and secret camps, and unleashed a devastating series of long-range strikes with devastating consequences for the Russians.

Russian President Vladimir Putin has reportedly directed his military to expel Ukrainian forces from Kursk by January 20, 2025, coinciding with the inauguration of US President-elect Donald Trump.

Trump, who has pledged to end the war swiftly, has not clarified his approach, leaving uncertainty about his strategy. Putin’s push appears aimed at projecting strength and regaining full territorial control ahead of any potential Trump-led peace negotiations.

To meet Putin’s directive, Russian commanders have begun redeploying additional troops from various units across Russia and the frontline. A Ukrainian soldier operating in Kursk reported the recent arrival of unspecified elements from the elite Russian 76th Air Assault Division, with Russian forces amassing approximately 4,000 personnel and 100 armored fighting vehicles prepared for further offensives.

This corroborates earlier reports of the division’s relocation from the Zaporizhia direction to Kursk in recent weeks. Additionally, North Korean troops supporting Russian efforts have been repositioned from rear bases to frontline positions, further bolstering the build-up.

Ukrainian commanders knew that this window of redeployment with increased activity brought a bigger risk of exposure for the Russian forces, so they exploited this situation by tracking and locating various enemy camps, warehouses, and command centers.

After gathering extensive information about potential key targets, Ukrainians decided to capitalize on that by striking them with various weapons, including drones and Storm Shadow missiles.

The initial target was a bunker at the Baryatinsky estate in Marino, approximately 30 kilometers from the Ukrainian salient in the Kursk region, serving as an operational headquarters for senior Russian commanders overseeing offensives in the area.

Russian military analysts reported that Ukrainian forces fired up to 12 Storm Shadow missiles, criticizing the ineffective Russian air defenses that failed to intercept the strike. Ukrainians later released geolocated footage from a Shark surveillance drone documenting the precision of the attack.

Western officials confirmed the effectiveness of the Storm Shadow missile strike on Russian targets, reporting dozens of casualties among high-ranking officers, including Russian Lieutenant-General Valery Solodchuk and a senior North Korean general.

While the North Korean officer’s identity remains undisclosed, Ukrainian intelligence previously identified General Colonel Kim Yong Bok as overseeing North Korean Special-Purpose Assault Corps units deployed in Russia.

Reports also indicate the strike killed or injured hundreds of regular troops, including approximately 500 North Korean soldiers preparing to support the Russian counteroffensive.

On the previous day, Ukrainian forces executed a large-scale drone strike targeting Russian rear areas, focusing on military and defense industrial assets in Voronezh, Belgorod, and Novgorod.

While Russian officials claimed their air defense systems intercepted or destroyed 44 Ukrainian drones, Lieutenant Andriy Kovalenko, head of Ukraine’s Center for Combatting Disinformation, reported that the drones successfully hit the 13th Main Missile and Artillery Directorate arsenal near Kotovo, Novgorod.

This facility housed ammunition for tube artillery, mortar mines, ballistic missiles, and air defense systems, including KN-23 missiles supplied by North Korea.

Ukraine’s Main Military Intelligence Directorate reported that their forces also struck another command post of the Russian Northern Grouping of Forces in Gubkin and various drone production sites located in the Belgorod region as well.

Overall, the Ukrainian preemptive strikes on Russian and North Korean forces in Kursk underscore the critical importance of intelligence-driven warfare and the vulnerabilities inherent in large-scale troop redeployments.

By exploiting Russia’s logistical weaknesses and operational predictability, Ukraine not only neutralized a significant portion of the incoming reinforcements, but also demonstrated its ability to strike deep into enemy territory with precision and strategic impact.

Today [ Dec 01, 6am ], there are a lot of important updates from the Kurakhove [ Donetsk ] direction.

Here, as Russian forces desperately amassed troops and supplies to intensify their assault on Kurakhove, Ukrainian defenders seized the moment with precision strikes. Tracking the enemy’s every move, they unleashed the devastating force of JDAM-guided bombs, obliterating key Russian bases and supply hubs in a series of airstrikes that destroyed the Russian’s plans for massive penetration.

Russian forces had previously established a presence in the eastern part of Kurakhove, specifically in the Roya residential district, which provided staging grounds for urban operations.

This encouraged an intensification of their assault on the town. However, the western Ukrainian-held part consists of 2 large districts of 9-floor high-rise buildings and the industrial zone around the Kurakhove Thermal Power Plant.

A narrow gully separates the eastern and western parts of the town, exposing Russian forces in the open to Ukrainian fire from the high-rises. Russian positions on the eastern outskirts, consisting of 1-story houses and a farm complex, were further disadvantaged, as they were under constant fire control from Ukrainian forces in the high-rise areas.

Despite their tactical disadvantages, Russian forces are pushing relentlessly to gain ground in the western part of Kurakhove, suffering severe losses, as Ukrainian defenders decimate their assaults.

However, to initiate any attack, the Russians must first deploy their forces into the part of the town they control. This has proven difficult, as Ukrainian drones maintain constant surveillance over the road connecting the Russian-held area of Kurakhove with their rear, complicating their movement and logistics.

Combat footage from the area shows Russian armored vehicles being destroyed on the road to Kurakhove by FPV drones.

The attrition caused by Russian columns, forced many soldiers to abandon their vehicles and seek cover in nearby ditches or tree lines. This only slowed their elimination, as Ukrainian drone operators targeted and destroyed the remaining survivors.

Many Russian tank crews, fearing brutal destruction from ammo detonations, which often obliterate tanks during intense assaults in Kurakhove, panicked and drove into ditches. As a result, most of the assaulting Russian forces were destroyed before reaching the town, forcing Russian command to order the survivors to dismount and hide in the eastern outskirts.

Given the significant challenges Russian forces face in even reaching the outskirts of Kurakhove, they are attempting to gather forces for assaults as close to the town as possible.

Ukrainian forces, recognizing the lack of cover and settlements for the Russians, have found it easier to detect movement and identify key logistical nodes. As a result, Ukrainian forces have intensified their precision strikes in the region, unleashing their stockpiles of JDAM-guided bombs.

The 1st target of the Ukrainian airstrike was a Russian base, at a prison over 6 km from Kurakhove, where soldiers and ammunition were deployed to sustain attacks on the town. The 2nd strike targeted a Russian base in Donetsk City, resulting in the destruction of a platoon-sized assault group with 4 BTR-82A armored vehicles.

These strikes are breaking down Russian forces by forcing them to reorganize and recover from hits on their command posts and force concentrations, disrupting their attacks. The 3rd strike hit a large building in Sontsivka, housing Russian stormtroopers preparing for further assaults on Kurakhove. Such airstrikes destroy large concentrations of Russian troops, forcing delays in their offensive plans on the northern flank, giving Ukrainians valuable time to reinforce their defenses.

Overall, the Russian offensive efforts around Kurakhove mark the decline of Russian tactical gains due to the predictability of their attacks and the vulnerability of their rear positions, which are being successfully targeted by the Ukrainians.

The lack of gains on most front lines and the impact of heavy losses and rear strikes on Russian forces will force them to reconsider their tactics and change their approach, if they want to achieve any meaningful territorial gains.

Ukrainian forces, on the other hand, managed to halt the Russian assaults and force them to pause their attacks for a while, giving them time to further reinforce their defenses to more effectively counter future Russian attacks.


8,955 posted on 12/01/2024 6:44:55 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8932 | View Replies]

To: PIF; All
🇷🇺 🇸🇾 🇹🇷 Russia says that 'Turkey has violated the Astana and Sochi agreements, and the Syrian Government has the full right to restore security in Aleppo using all types of weaponry and methods, and by any means necessary'

https://x.com/Megatron_ron/status/1862624426417680700

I am confused...which is binding IAW international law?

A phrase that was part of an assurance, made by someone who is not authorized to make an assurance? No.
A promise made to a country that no longer exists? No
A signed agreement between 2 countries that exist? Yes
A signed treaty between 2 countries that exist? Yes.

Of course, ruzzia breaks agreements and treaties whenever their dictator decides to.


8,956 posted on 12/01/2024 7:13:38 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8955 | View Replies]

To: PIF
Shooting down Russian reconnaissance drones with our FPVs, now at night.💥

https://x.com/UaCoins/status/1863165955456610652

I am amazed at UKF's ability to locate the Russian reconnaissance drones.


8,957 posted on 12/01/2024 7:20:01 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8956 | View Replies]

To: FtrPilot
Side note: Russia is withdrawing from countries it previously supported as it cannot spare money, weapons or military personnel. When Russia's pressure is reduced, it leads to what is happening now in Georgia and Abkhazia (which is part of Georgia occupied by Russia) and especially in Syria. Here is more on the mess in Syria (which should really be its own thread.)

Clearing the Confusion: HTS, Turkish Proxies, and the Threat to Rojava (AANES)

1/ A lot of confused “experts”: What are the goals of Hay’at Tahrir al-Sham (HTS) and Turkish-backed SNA? How do their actions threaten Rojava (AANES)? Let's clarify.

At the heart of this chaos are two key operation rooms, Al-Fath al-Mubin (الفَتح المُبين) and Fajr al-Hurriya (فجر الحرية). While both are rebel coalitions, their objectives and loyalties couldn't be more different.
Al-Fath al-Mubin, led by HTS, is a jihadist coalition enforcing strict sharia law, focused on fighting Assad's regime.

- Fajr al-Hurriya, however, is a Turkish-backed Islamist mercenaries, created to dismantle Kurdish autonomy and serve Ankara's interests.

Despite its rapid advances, HTS operates—within certain parameters—independently of Turkey. During the 2018 Afrin offensive, HTS did not participate, as it was busy attacking rival factions, a move that angered Ankara.

HTS’s goals do not always align with Turkey's.

In contrast, the Fajr al-Hurriya operation room is a rebranding of Turkish-backed militias, notorious for recycling ISIS veterans as with Ahrar al-Sharqiyah.

Their raison d’être? The destruction of the AANES, and the erasure of Kurdish identity from Turkey's border.

Read more
https://threadreaderapp.com/thread/1862971691455988070.html

https://en.wikipedia.org/wiki/Autonomous_Administration_of_North_and_East_Syria

If you are an analyst focusing on Syria and Turkey and have been away from the information flow for a few weeks due to vacation, it takes several days to catch up.

PS: None of these are good guys

8,958 posted on 12/01/2024 7:27:04 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8950 | View Replies]

To: PIF
Frontline report: Russian 3-month assault on Chasiv Yar collapses.

Troops trapped in basements, under constant Ukrainian drone watch.

Narrow bridgehead near Kalynivka becomes a deadly kill zone

https://x.com/EuromaidanPress/status/1862984161792848342

Weren't we told that ruzzia would stroll to Chasiv Yar after they captured Bakhmut?

8,959 posted on 12/01/2024 7:28:27 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8957 | View Replies]

To: gleeaikin
I plan to leave God alone for a while

Somewhere Zelensky is smiling.

8,960 posted on 12/01/2024 7:35:10 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8934 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,921-8,9408,941-8,9608,961-8,980 ... 18,661-18,673 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson