Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,721-8,7408,741-8,7608,761-8,780 ... 18,701-18,702 next last
Another sign showing how dire the situation has become for the Russian population.

Many Russians - even when they keep their mouth shut - are already feeling what's happening and the worst is yet to come. The Russian economy has been so absolutely ravaged for propelling this war to the extent that it cannot do anything else than to continue it. But if it continues it, it will only increase the structural problems which caused this disaster to unfold in the first place. It is a vicious cycle, which in the end will make the whole economy collapse.

Russia is not only losing 30,000 - 50,000 troops a month, but 30,000 - 50,000 people of the Russian workforce. The wounded are even more of a “liability” than the dead. The dead you just burry, if you can retrieve the body, end of the story. The wounded will burden the society for decades to come, and will require additional resources.

Russia's future is in tatters. It is bleak no matter what you project, but under Putin is will tailspin to the very bottom, break through the ground, and incinerate in the basement. Under normal circumstances, a population would dispose the leadership, bring this war to a halt, and start negotiations in order to save what can be saved.

But Putin and his entourage are leaders of sheep and are steering Russia directly to the cliff, hoping that they will be saved by external factors, before reaching the edge. It is a chickengame where Russia drives the Lada and we a Mercedes truck, while Russia hopes that we make space before the Lada gets squashed by the cooling grill of the truck.

This is why Russia is escalating its rhetorics. But bluffs remain bluffs. Ask anyone in China, India, Brazil, the West or elsewhere if we want to be held hostage for Russia's miscalculations and the answer is a clear “no!”. Russians brought this on themselves and 8 billion humans are not going to pay for their failed imperial adventures. Just imagine if Russians do really something unusually stupid and cross the nuclear line, millions of guns from 200 countries and territories will lock on Russia and will end this misery once and for all. It would the road of hell, but we would bury Russia once and forever.

Nothing is more just than defending your home from a foreign invader. Ukraine is defending it and it has all reason to do so, even by striking right into Russia's heart, right into Moscow and if necessary with Western weapons. It is morally and legally in accordance with international law. If you force or only expect Ukraine to accept a foreign invader on its soil, even temporarily, it would only signal two things:

1.) You can extend your territory by wars
2.) Only nuclear weapons can stop point 1

Both points will be nothing less than the first installment of WW3, and unlike to what is happening right now, this one nobody can stop, because it is chaotic. You wouldn't be able to contain all the desires around the globe for unsresolved border issues. It would be absolute madness, nobody not even a coalition of all current nuclear powers could stop this. This is something that previous generations understood when they curtailed nuclear proliferation, one of the few achievements of international cooperations which generally worked out to an manageable extent.

Only a rule-based order, where borders are never changed by force, can save us from total and global war. The line where this was only about Ukraine alone, has been crossed a long time ago. This is about all of us. This is why we have to break imperial Russia and make an example of it, so that nobody dares to do something even remotely in our own countries. We are all into this.

https://x.com/tendar/status/1860660643231146294

8,741 posted on 11/26/2024 1:10:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8740 | View Replies]

Sebastian Gorka, Trump's nominee for Director of National Security Policy, calls Putin a “murderous, former KGB colonel” and a “thug”.

He then claims that Trump plans to end the Ukraine by threatening to flood Ukraine with more military “aid”.

https://bsky.app/profile/pstyleone1.bsky.social/post/3lbtkdl67l22r
video

8,742 posted on 11/26/2024 1:16:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8741 | View Replies]

Russian deserter reveals war secrets of guarding nuclear base

The volunteer organisation that helps deserters, “Idite Lesom” [’Go by the Forest’, in English, or ‘Get Lost’] has told the BBC that the number of deserters seeking help has risen to 350 a month.

https://www.bbc.com/news/articles/c9dl2pv0yj0o

8,743 posted on 11/26/2024 1:23:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8742 | View Replies]

To: FtrPilot

The pro-Russian trolls on FR have the chutzpah to speak in terms of Ukraine escalating the war. Russia is responsible for the all-out war and the land grabs of 2014. The Neo-Stalinists in Moscow spend the big bucks on propaganda and subversion and that money reaps results as demonstrated by the number of Freepers who support the brutal Russian aggression. In the old Cold War, such Moscow sympathizers were known as the Soviet’s useful idiots.


8,744 posted on 11/26/2024 1:39:42 AM PST by Monterrosa-24 (Saludemos la patria orgullosos)
[ Post Reply | Private Reply | To 8729 | View Replies]

To: AdmSmith

Here’s the difference between the YouTube report and the website:

“If you subscribe to our website you will not only give us full independence from YouTube and other platforms, but also allow us to deliver you more in-depth analytical videos every single week. On top of regular tactical videos, you will get strategic overviews of the fronts, and strategic geopolitics insights, that cover a much greater scale of things. Our website will be the only source on the internet from which you will be able to get everything you need to know about world developments, in just under 20 minutes a day.”

You get not only the tactical report (below), but also in-depth analysis and otherwise censored videos.

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ No Chance to Survive. Russian Expose Themselves, Waiting For Disaster ]


Today [ Nov 26 ], there are a lot of important updates from the Velyka Novosilka direction.

Here, after an intense and ultimately unsuccessful push to encircle Kurakhove, Russian forces found their offensive grinding to a halt under stiff Ukrainian resistance. In a desperate pivot to regain momentum, they shifted their focus westward to Velyka Novosilka, setting the stage for a decisive battle.

The primary Russian objective in this region was to break through Ukrainian defenses west of the salient and advance toward Kostiantynopil. Capturing this position would have enabled Russian forces to sever Kurakhove from the mainland and encircle Ukrainian troops in the salient. Anticipating this, the Ukrainian command acted decisively, fortifying the defensive line in front of Kostiantynopil to block any potential Russian breakthrough.

The Russian offensive from the south eventually stalled as Ukrainian defenses, properly reinforced, resisted the advance, while Russian forces grappled with overextended logistics and combat fatigue from relentless frontal assaults. Recognizing the diminishing prospects of reaching Kostiantynopil, Russian command shifted their strategy.

Rather than continuing northward, they redirected westward, banking on the assumption that Ukrainian reinforcements for Kostiantynopil had been drawn from Velyka Novosilka - an area that had not been heavily contested. Seizing this opportunity, Russian forces attempted to outflank Velyka Novosilka instead of targeting Kurakhove.

Russian forces launched two distinct attack vectors in their operation. The first vector advanced directly from Zolota Nyva toward Velyka Novosilka via the main highway. This assault was not intended to breach the town itself, but aimed to pin Ukrainian troops in place, preventing them from reinforcing nearby areas such as Rozdolne.

The second vector targeted Rozdolne from Shakhtarske, with the primary objective of severing a key logistical route leading to Velyka Novosilka. If we look at the topographic map, we can see that Ukrainian supply lines in this area traverse lowlands, making them more vulnerable to Russian fire control. While alternative routes to the town exist, disrupting these supply lines aligns with the broader Russian strategy of undermining Ukrainian logistics.

However, Russian forces also face significant tactical disadvantages. Their advances rely heavily on a network of small, dispersed villages connected by open fields and a limited number of paved roads, making their attack routes highly predictable. This predictability grants Ukrainian forces a critical advantage, as they can more effectively identify Russian preparations for assaults.

Additionally, the large distances Russian troops must traverse to concentrate forces in key staging areas, such as Shakhtarske and Zolota Nyva, hinder their ability to deploy large formations without detection. Ukrainian reconnaissance drones further compound this issue, making it challenging for Russian forces to mobilize covertly.

Combat footage from the Ukrainian Presidential Brigade highlights a Russian platoon-sized attack near Velyka Novosilka, involving three to four armored vehicles and tanks. Due to the extensive open fields they must traverse, Russian vehicles are swiftly detected and targeted by Ukrainian drone operators. Despite suffering vehicle losses, Russian soldiers promptly dismounted and sought refuge in nearby tree lines to avoid becoming larger targets aboard their vehicles.

While some managed to evade destruction through concealment, a significant number were neutralized. Such engagements occur multiple times daily east of Velyka Novosilka, resulting in scattered survivors from decimated units gradually accumulating in tree lines, which Russians claim to be secured. However, despite repeated attempts, Russian forces failed to secure their objectives in the area.

Overall, the shift in Russian focus from Kurakhove to Velyka Novosilka underscores the limitations of their current operational capacity and highlights the adaptability of Ukrainian defenses. While the Russian attempt to outflank Ukrainian positions reveals a strategic pivot, their reliance on predictable routes and exposed formations continues to leave them vulnerable to precise Ukrainian countermeasures.

This development not only demonstrates the effectiveness of Ukraine’s defensive strategies, but also signals that Russian forces are increasingly stretched thin, facing significant logistical and tactical constraints that could shape the outcome of future engagements in the region.


8,745 posted on 11/26/2024 3:08:36 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8738 | View Replies]

To: FtrPilot

ATACMS Hit Airfield In Russia For The First Time
Satellite imagery is inconclusive as to what damage was inflicted on the base, which no longer hosts large contingents of Russian aircraft.
https://www.twz.com/news-features/atacms-hit-air-field-in-russia-for-the-first-time


8,746 posted on 11/26/2024 3:09:16 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8731 | View Replies]

To: PIF

Czech intelligence chief Michal Koudelka has spent decades uncovering Russian spy networks, sabotage attempts and disinformation campaigns against Europe.

Speaking in an interview from a high-security compound on the outskirts of Prague, he is now warning allies that pushing Kyiv to accept significant concessions in order to end the war in Ukraine would only embolden the Kremlin.

“Russia would spend perhaps the next 10 to 15 years recovering from its huge human and economic losses and preparing for the next target, which is central and eastern Europe,” said Koudelka, a major general who heads the country’s Security Information Service. “If Ukraine loses, or is forced to accept a bad peace deal, then Russia will perceive that as victory,” he added.

https://www.bloomberg.com/news/articles/2024-11-26/top-czech-spy-warns-nato-against-pushing-bad-peace-in-ukraine


8,747 posted on 11/26/2024 3:17:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8746 | View Replies]

To: PIF

I’m all these glowing “patriot “ claims there is never the admission that none of this, well not as much, would be happening if the war had not been started.

So Russians suffer for dear leader and his desires.

The greatest threat to Russia is not Ukraine or NATO, but Putin


8,748 posted on 11/26/2024 3:22:11 AM PST by blitz128
[ Post Reply | Private Reply | To 8737 | View Replies]

To: AdmSmith

RUSSIA TO WEST: SENDING NUKES TO UKRAINE WILL BE THE START OF WW3

Following reports that Biden is considering deploying nuclear missiles to Ukraine, Deputy Chairman of the Russian Security Council warned:

“Transferring nuclear weapons to Kyiv would be preparation for a… pic.twitter.com/WwQpvIkb3Z— Mario Nawfal (@MarioNawfal) November 26, 2024


8,749 posted on 11/26/2024 3:55:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8747 | View Replies]

To: JonPreston
Speedy, Last seen on 11/02/24


8,750 posted on 11/26/2024 3:58:05 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8749 | View Replies]

To: JonPreston

According to the usuals WW3 has already started. Which is it?


8,751 posted on 11/26/2024 4:31:32 AM PST by blitz128
[ Post Reply | Private Reply | To 8749 | View Replies]

To: JonPreston

I miss him as well hope everything is okay. Appreciate your concern.


8,752 posted on 11/26/2024 4:33:29 AM PST by blitz128
[ Post Reply | Private Reply | To 8750 | View Replies]

To: JonPreston

USD/RUB - US Dollar Russian Rubble

105.6575

https://www.investing.com/currencies/usd-rub


8,753 posted on 11/26/2024 4:53:33 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8749 | View Replies]

Chinese Bulker Yi Peng 3 | Sailed from Russia | Accused of Severing Two Baltic Cables | What is Going on With Shipping?

In this episode, Sal Mercogliano—a maritime historian at Campbell University (@campbelledu) and former merchant mariner—discusses the voyage of MV Yi Peng 3 from Russia through the Baltic and the potential for the ship to have severed the C-Lion1 and BCS East-West submarine cable.
https://www.youtube.com/watch?v=a7cS1aVGwUE


8,754 posted on 11/26/2024 4:58:27 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8520 | View Replies]

To: PIF
Кремлевская табакерка:

26NOV Putin's security will be seriously strengthened because of internal enemies. They are “scared of NATO and a nuclear war”

The decision to strengthen Vladimir Putin's security has been brewing for a long time. But it was finally made after threats from NATO Admiral Rob Bauer. Let us recall that he stated that the alliance was discussing preventive high-precision strikes on Russian territory. “To be honest, we are not particularly afraid of NATO. Let them bark, it is a threat, but not the biggest one. But there are people who have long been scared of the West. And they can pose a threat to Vladimir Vladimirovich. Therefore, we are dramatically strengthening the president's security,” a source in the FSO told us.

We wrote : after Russia used the Oreshnik system and the escalation of the conflict with the West, the FSB received a signal about preparations for an assassination attempt on Putin. Most likely, the president is wanted to be killed by certain representatives of our elites who are afraid of a nuclear war or simply a major conflict with NATO. The main threat to Vladimir Vladimirovich's life now obviously comes from such internal enemies.

“There are alarmists, there are stupid fears of a nuclear war. The names of the alarmists are being found out now. We will protect Vladimir Vladimirovich from them. He will not even notice that they have started to guard him more actively,” another source in the FSO explained.
https://t.me/kremlin_secrets/4952

No one is scared of nuclear war, they just want to live as normal people, and that requires Putin to Putout.

8,755 posted on 11/26/2024 5:19:17 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8754 | View Replies]

To: blitz128
May he find peace.

All this war talk negatively impacts the nervous system and the immune system. It creates a destructive state of mind that wreaks havoc with your physical health and emotional well-being.

8,756 posted on 11/26/2024 6:52:36 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8752 | View Replies]

BREAKING: NATO now discussing the possibility of preemptive strikes against Russia — NATO's Military Committee Chairman, Rob Bauer — Douglas Macgregor (@DougAMacgregor) November 26, 2024


8,757 posted on 11/26/2024 7:02:49 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8756 | View Replies]

To: PIF
Yi Ping 3:

Cables connecting Germany and Finland, as well as Lithuania and Sweden in the Baltic Sea, have been damaged by fish, said Andrei Kartapolov, head of the State Duma Defense Committee. “I think it was a sawfish,” he said , answering journalists’ questions about Russia's involvement in the incidents.

https://www.moscowtimes.ru/2024/11/21/glava-komiteta-gosdumi-pooborone-obvinil-ribu-pilu-vobrive-dvuh-kabelei-vbaltiiskom-more-a148295

Of course, there are no swordfish in the Baltic Sea.
https://en.wikipedia.org/wiki/Swordfish

8,758 posted on 11/26/2024 7:47:53 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8754 | View Replies]

To: JonPreston

We now know why Russia does what it does: it cannot understand the non-Russian world and has a lousy interpreter who gives a distorted version to Putler.

Robert Bauer:
The North Atlantic Alliance would be wise to strike Russia’s launchers in the event of Russian attack. However, NATO countries will not be the first to attack, stated Admiral Rob Bauer, Chairman of the NATO Military Committee, during a discussion at the European Policy Center.

“The idea is that we are a defensive alliance, so we will only sit and wait until we are attacked. And when we are attacked, we will be able to shoot down the arrows (missiles - ed.) that come to us. But it’s smarter not only to do that but also to attack the archer that is in Russia if Russia attacks us,” Bauer said.

He emphasized that NATO countries need to destroy weapons systems that are used to strike at the Alliance. “And, of course, because we are a defensive alliance, we will have to take the first blow,” he added.

https://newsukraine.rbc.ua/news/nato-official-says-it-is-necessary-to-strike-1732557226.html


8,759 posted on 11/26/2024 8:01:27 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8757 | View Replies]

To: AdmSmith
Multiple Russian channels are reporting that their forces "withdrew" from #Kupyansk and are calling the failed attempt to capture the city a "disgrace."

UA side: "The Ukrainian Armed Forces have completed the cleanup of Kupyansk in the Kharkiv region." – DeepState

https://x.com/UKikaski/status/1861376892013592738


8,760 posted on 11/26/2024 8:53:52 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8759 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,721-8,7408,741-8,7608,761-8,780 ... 18,701-18,702 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson