Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,221-8,2408,241-8,2608,261-8,280 ... 20,201-20,203 next last
To: BeauBo

7 Tu-95s now.


8,241 posted on 11/12/2024 7:42:45 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 8240 | View Replies]

To: BeauBo

Launch of 50 cruise missiles reported. Will know if real or simulated in one hour.


8,242 posted on 11/12/2024 8:12:04 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 8240 | View Replies]

To: marcusmaximus

Russian Offensive Campaign Assessment, November 12, 2024

Recent Western and Ukrainian estimates about the size of the Russian force grouping in Kursk Oblast do not represent a significant inflection, as Russian forces have spent several months gathering forces for a future counteroffensive effort to expel Ukrainian forces from Russian territory. Ukrainian officials and Western media recently reported that Russia has concentrated a rough total of 50,000 personnel, including about 8,000 - 10,000 North Korean forces, in Kursk Oblast in preparation for an operation to push Ukrainian forces from Russian territory before late January 2025 and suggested that Russia has not redeployed any of these forces from eastern Ukraine.[19] Ukrainian sources estimated in September and October 2024 that Russian forces had already concentrated between 30,000 and 50,000 personnel in Kursk Oblast, including an estimated 35,000 personnel from Russia’s Northern Grouping of Forces who were operating in Kursk, Bryansk, and Belgorod oblasts and northern Kharkiv Oblast prior to the Ukrainian incursion in Kursk Oblast in August 2024.[20] US Secretary of Defense Lloyd Austin stated on October 31 that 8,000 North Korean soldiers are also currently operating as part of the larger Russian force grouping in Kursk Oblast.[21] A Ukrainian servicemember stated on November 11 that Russian forces are also redeploying additional elements of the 104th Airborne (VDV) Regiment (76th VDV Division) and several battalions of the 177th Naval Infantry Regiment (Caspian Flotilla) from western Zaporizhia Oblast to Kursk Oblast, but ISW has not observed independent indications of these redeployments as of this report.[22] ISW observed reports in mid-October 2024 that elements of the 177th Naval Infantry Regiment were operating near Chasiv Yar.[23] Ukraine’s Pivnich (Northern) Operational Command Spokesperson Colonel Vadym Mysnyk reported on November 11 that the Russian military is frequently transferring new reserves to Kursk Oblast due to high personnel and equipment losses.[24] These reserves are likely intended to replace personnel losses and not significantly bolster the existing Russian force grouping in the area.

Russian Mobilization and Force Generation Efforts (Russian objective: Expand combat power without conducting general mobilization)

The Russian military reportedly continues to coerce conscripts into signing Russian military service contracts, likely as part of ongoing crypto-mobilization efforts. Russian opposition outlet Mobilization News reported on November 12 that Russian commanders coerced conscripts subordinated to the Russian 80th Tank Regiment (90th Tank Division, Central Military District [CMD]) into signing volunteer service contracts with the Russian Ministry of Defense (MoD).[79]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-november-12-2024


8,243 posted on 11/12/2024 11:33:21 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8189 | View Replies]

1 770 or 1.23 Russian/min


8,244 posted on 11/12/2024 11:37:08 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8190 | View Replies]

To: AdmSmith

800,000 will come sooner rather than later. I wounder if Norks count as Russians, or like LNR/DNR troops, are not counted at all?


8,245 posted on 11/13/2024 2:42:05 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8244 | View Replies]

To: AdmSmith; PIF
1770!

Meat wave attacks in Kursk are impacting all of the numbers.

Russian heavy equipment and supply vehicles being targeted by Ukrainian FPV drones from the 1st Special Operations Detachment in the Kursk region

https://x.com/NOELreports/status/1856652748487381078

4:24 video at the link above.


8,246 posted on 11/13/2024 4:04:07 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8244 | View Replies]

To: marcusmaximus; BeauBo
So far, this is the only x.com post WRT the attack.

The russians have attacked Kyiv with ballistic missiles.

With bombers protected by Biden.

https://x.com/jurgen_nauditt/status/1856574107434754256


8,247 posted on 11/13/2024 4:09:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8242 | View Replies]

To: PIF; BeauBo
⚡️ According to preliminary information, the car that exploded in Sevastopol was carrying a captain of the 1st rank of the Black Sea Fleet

https://x.com/PStyle0ne1/status/1856607864150008190

Partisans!

8,248 posted on 11/13/2024 4:12:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8247 | View Replies]

To: PIF
The Ukrainian Air Force reported on a missile and drone attack.

Shot down:
0/2 S-300 ballistic missiles
2/2 Kh-101 cruise missiles
2/2 Iskander-M/KN-23 ballistic missiles
84/90 Shahed drones (37 shot down, 47 downed by electronic warfare)

Two more drones left towards Russia.

https://x.com/NOELreports/status/1856612781946028375


8,249 posted on 11/13/2024 4:17:37 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8248 | View Replies]

To: blitz128

😂 The Economist reports Kiev is “concerned” about Pompeo not being in Trump’s cabinet.



Yeah, wonder if that’s because they’ve already paid him millions through Kievstar based on assurances he would be.

— Baron of the Taiga (@baronitaigas) November 12, 2024


8,250 posted on 11/13/2024 4:30:43 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8229 | View Replies]

To: PIF
Information appeared online that the captain killed in Sevastopol was Valeriy Trankovskiy, head of staff of missile ships in the Black Sea Fleet.

Transkovskiy is a war criminal who gave orders to launch cruise missiles at civilian objects in Ukraine that killed a lot of civilians.

https://x.com/Gerashchenko_en/status/1856648361396388183

Another war criminal disposed of.

8,251 posted on 11/13/2024 4:38:11 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8249 | View Replies]

To: JonPreston

I would imagine they are, plenty of corruption to go around, but I will stick to my prediction. Trump is not going to be the “friend” Putin thinks he will.

Obama said Isis could not be stopped, Trump came in and said get it done and it was over in months.

We will see what happens.

Heard wildberry is having a Going out of business sale, better jump on the deals 😂


8,252 posted on 11/13/2024 4:47:31 AM PST by blitz128
[ Post Reply | Private Reply | To 8250 | View Replies]

To: PIF
Russian paratroopers arrive on the Kursk front

https://x.com/bayraktar_1love/status/1856666363806265694


8,253 posted on 11/13/2024 4:48:26 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8251 | View Replies]

To: PIF
As the weather gets colder, communal collapse resumes in Russia: according to local media, a part of Yekaterinburg turned into a sauna due to a leak in pipes. So far, the exact location of the leak has not been found. Asphalt started to collapse in that area of the city.

It is minus 3 degrees Celsius in Yekaterinburg and snowing today, weather websites report.

Putin doesn't care how many Russians suffer as he spends billions on war every day.

https://x.com/Gerashchenko_en/status/1856637552024764910


8,254 posted on 11/13/2024 4:56:00 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8253 | View Replies]

To: PIF
🔥The 🇷🇺 Russian invader, whose comrade had been destroyed by a FPV drone of the 🇺🇦 47th Mechanised Brigade a short time earlier, resigned himself to his fate and simply waited for the next drone.

https://x.com/GloOouD/status/1856577393009537383


8,255 posted on 11/13/2024 5:04:56 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8254 | View Replies]

To: blitz128
I would imagine they are, plenty of corruption to go around, but I will stick to my prediction.

This sentence makes no sense.

I'm guessing you meant to say, "I would imagine they are, there is plenty of corruption to go around, but I will stick to my prediction.

Once again I'm begging you to smarten up.

8,256 posted on 11/13/2024 5:25:11 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8252 | View Replies]

To: PIF
🇧🇾 For the fourth consecutive day, Russian drones have been flying into Belarus en masse, reports monitoring group "Belarusian Hajun".

Last night, at least 12 drones crossed from Ukraine into Belarus, with two reportedly lost on Belarusian territory.

Belarusian aviation was reportedly deployed to respond to the drone threat.

https://x.com/NOELreports/status/1856660756013449612

UKF Electronic Warfare (EW)?

8,257 posted on 11/13/2024 5:30:58 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8255 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ New Record! Ukraine Launches Biggest Strike Yet! ]


Today [ Nov 13 ], there is a lot of news from the Russian Federation.

Here, in a daring raid, Ukrainian forces made the biggest drone attack yet against Moscow.

Ukrainians continue to use their latest drone developments to target critical Russian infrastructure, including airfields, oil depots, and military bases. The goal of these is to disrupt Russian offensive operations against both the Ukrainian armed forces and the country’s civilian population.

First of all, Ukrainian drones targeted Russia’s capital, Moscow. According to Russia’s Ministry of Defense, 84 Ukrainian drones were intercepted over 6 regions, with nearly half approaching Moscow and causing flights to be diverted from 3 major airports in the area.

This was the largest attack on the Russian capital since the start of the war and was described as massive by local officials. Footage released by residents, who defied government orders, not only contradicted official claims that no damage occurred, but also showcased the aftermath of the strikes, including the operations and locations of Russian air defense units.

Officials reported that most of the drones were intercepted over the Ramenskoye, Kolomna, and Domodedovo districts. The Russian Ministry of Defense claimed that 34 drones were shot down over the town in total.

Earlier Ukrainian forces struck Russian ammunition warehouses in the Bryansk region, during another large-scale drone attack. The Ukrainian General Staff reported that drone operators of the Unmanned Systems Forces successfully hit warehouses at the Russian military’s 1060th Logistics Center, known for storing missiles of various types, causing initial explosions and secondary detonations at the facility with geolocated imagery showing 2 large fires burning near it.

Bryansk was also targeted 10 days before that when one of the largest microelectronics plants in Russia caught fire after a drone strike.

This plant is located over 100 kilometers north of the border with Ukraine’s northern Sumy region and was attacked at least once before as well. It produces key components used widely in Russian defense production, including Pantsir air defense and Iskander missile systems.

In parallel, Ukrainian forces have maintained a series of strikes on military training camps in Russian border regions, seeking to disrupt Russia’s efforts to train newly mobilized troops. These operations are often executed with high precision, aided by reconnaissance drones for fire correction.

One recent strike targeted a tent encampment at a Russian military training ground in the Rostov region, with geolocated video footage revealing significant damage. Russian military officials reported that the attack took place overnight, catching many soldiers from the 150th Guards Motorized Rifle Division while they were resting in their tents.

Lately, Ukrainian forces have escalated attacks on Russian military positions, both within Ukraine and across the border, frequently focusing on such training grounds to weaken Russian capabilities.

On the night of November 7th, units from Ukraine’s Main Military Intelligence Directorate executed a significant drone strike on an oil refinery in Saratov Oblast, reportedly causing damage to the facility’s infrastructure.

Social media footage captured a fire near the refinery, while a local Telegram channel reported that debris from a downed drone struck a fuel oil tank and a specialized installation. The refinery, a subsidiary of the Russian state oil company Rosneft, is said to produce approximately 7 million tons of oil annually.

A similar attack was conducted on the Aleksin Chemical Plant in Tula Oblast with 13 drones causing a fire, halting the plant’s operations, and eventually causing a chemical explosion. This key factory produces ammunition, gunpowder, and other products for the Russian defense industrial base.

Around the same time, Ukrainian military intelligence drone operators carried out a surprising long-range attack on a Russian naval base in the Dagestani port city of Kaspiysk using their domestically produced A-22 Flying Fox drone.

The base houses Russia’s Caspian Flotilla, along with Russian Marines and Coastal Troops. Reports indicate that the strike damaged at least two vessels - the missile ships Tatarstan and Dagestan - and potentially several smaller Project 21631 ships.

This targeted fleet has been involved in strikes against Ukraine, while the 177th Marine Regiment stationed at the base has seen combat in the Kherson and Zaporizhzhia regions. Despite Russian authorities claiming that all drones were intercepted, social media videos suggest otherwise, showing drones hitting their targets and causing large explosions. The incident occurred approximately 15 kilometers from a local airport, which has since suspended operations indefinitely.

Overall, Ukraine is trying to keep all options open and is ramping up the domestic production of long-range munitions to not only bypass restrictions on the usage of Western-supplied weapons but also to intensify strikes in the deep Russian rear at a crucial moment.

This aims at causing premature culmination during the time the Russian offensive is at its peak which can ultimately lead to stagnation of the enemy’s efforts. The idea is not only to cripple all possible efforts of the Russian army by deranging logistics and targeting training grounds, but to cause long-term negative effects.


8,258 posted on 11/13/2024 6:06:44 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8249 | View Replies]

To: FtrPilot
In the Novosibirsk region, Russian soldiers staged a riot in a barracks and fled to avoid dying in the war against Ukraine.

https://x.com/wartranslated/status/1856709257086783933

Novosibirsk Oblast on Google Maps


8,259 posted on 11/13/2024 7:07:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8257 | View Replies]

To: PIF
The crew of the Leopard tank smash a column of Russian armored vehicles to pieces. True professionals and heroes of the 33rd Brigade of Ukraine!

Russian losses in this column: 47 infantrymen, 2 tanks, 1 BTR, 3 combat armored vehicles, 1 motorcycle.

https://x.com/bayraktar_1love/status/1856699381300236663


8,260 posted on 11/13/2024 7:52:19 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8259 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,221-8,2408,241-8,2608,261-8,280 ... 20,201-20,203 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson