Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,521-7,5407,541-7,5607,561-7,580 ... 21,001-21,005 next last
To: PIF; All

Quoting Ralston:

“In 2022 [NEVADA], the Dems had a 21,000-ballot lead after Week One. In 2020, the Dems had about a 50,000-ballot lead after one week.”

Right Now, Rs have a 16,400 ballot lead after 5 days. Tomorrow night, week 1 will be done. Saturday morning should have complete week 1 numbers.


7,541 posted on 10/24/2024 5:37:38 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7540 | View Replies]

To: PIF; All

More Ralston [slight panic in the tone?]

“The Dems almost always do better in the second week, and they need to in 2024, not to build an insurmountable lead, as they have in the past, but to stay in the game. I don’t know of any smart Dem who thinks this is going to be anything but a slog and a 50-50 race possibly decided by a few thousand votes.

What they don’t say is this: That may be a best-case for them at this point, to be that close.”


7,542 posted on 10/24/2024 5:40:41 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7541 | View Replies]

To: PIF; All
Dem registration advantage in Nevada will be down to 10,000 by election day.

"In 2020, Democrats had an 87,000 voter registration advantage."






7,543 posted on 10/24/2024 5:49:46 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7542 | View Replies]

To: PIF; All

More Rs who voted 0 times in the last 4 elections, 1 time and 2 times in the last 4 elections are early voting in Nevada vs Ds.

“Nevada: Low Propensity Voters are getting off the couch and voting early

GOP 2 of 4 voters - 25.3% Turnout
DEM 2 of 4 voters - 20.9% Turnout

GOP 1 of 4 voters - 23.6% Turnout
DEM 1 of 4 voters - 18.6% Turnout

GOP 0 of 4 voters - 17.8% Turnout
DEM 0 of 4 voters - 13.9% Turnout”

https://x.com/jeremybhughes/status/1849580411665473581


7,544 posted on 10/24/2024 5:52:11 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7543 | View Replies]

To: PIF; All

(GOP consultant) Jeremy Hughes thinks Trump will win Nevada by 10-20,000 votes when all is said and done.

If so, Rosen could be an upset loser there to Sam Brown.

“Republican super PAC makes last-ditch push to swing Nevada Senate race”

“Republicans are optimistic Trump can win Nevada, and they are looking to boost GOP Senate candidate Sam Brown against Democratic Sen. Jacky Rosen.”

https://www.nbcnews.com/politics/2024-election/republican-super-pac-makes-last-ditch-push-swing-nevada-senate-race-rcna177071


7,545 posted on 10/24/2024 6:02:59 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7544 | View Replies]

To: PIF; All

“It might be the best [NEVADA] environment Republicans have seen in a presidential year in 20 years,” Nevada GOP strategist Jeremy Hughes recently told NBC News.


7,546 posted on 10/24/2024 6:05:35 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7545 | View Replies]

To: PIF; All
“ITS OVER!”




7,547 posted on 10/24/2024 6:28:40 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7546 | View Replies]

To: PIF; All

“Elon Musk’s Secret Conversations With Vladimir Putin”

“Elon Musk, the world’s richest man and a linchpin of U.S. space efforts, has been in regular contact with Russian President Vladimir Putin since late 2022.

The discussions, confirmed by several current and former U.S., European and Russian officials, touch on personal topics, business and geopolitical tensions.

At one point, Putin asked the billionaire to avoid activating his Starlink satellite internet service over Taiwan as a favor to Chinese leader Xi Jinping, said two people briefed on the request.”

////

“Knowledge of Musk’s Kremlin contacts appears to be a closely held secret in government. Several White House officials said they weren’t aware of them. The topic is highly sensitive, given Musk’s increasing involvement in the Trump campaign and the approaching U.S. presidential election, less than two weeks away.”

[PAYWALL] https://www.wsj.com/world/russia/musk-putin-secret-conversations-37e1c187?mod=hp_lead_pos1


7,548 posted on 10/24/2024 7:06:47 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7547 | View Replies]

To: SpeedyInTexas
“They’re fair game,” National Security Council spokesperson John Kirby told reporters Wednesday, saying the U.S. believes at least 3,000 North Korean soldiers have already arrived in eastern Russia by sea. The soldiers moved this month and are being trained at multiple Russian military bases, Kirby said.

“They're fair targets, and the Ukrainian military will defend themselves against North Korean soldiers the same way they’re defending themselves against Russian soldiers,” he said. “There could be dead and wounded North Korean soldiers fighting against Ukraine.”

Ironically, western allies are more likely to authorize strikes on Russian territory (with western weapons) when those strikes are against North Korean forces. Killing North Koreans is not "escalation".

7,549 posted on 10/24/2024 9:52:12 PM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 7548 | View Replies]

Russian Offensive Campaign Assessment, October 24, 2024

Russian President Vladimir Putin failed to deny the presence of North Korean military personnel in Russia on October 24, amid official Ukrainian reports that the first North Korean military units arrived in Kursk Oblast on October 23. Ukraine's Main Military Intelligence Directorate (GUR) reported on October 24 that the first units of North Korean personnel arrived in Kursk Oblast on October 23.[1] The GUR reported that the North Korean personnel trained at the Baranovsky military training ground in Ussuriysk, Primorsky Krai; the Donguz military training ground in Ulan-Ude, Republic of Buryatia; the Yekaterinoslavsky military training ground in Yekaterinslavka, Amur Oblast; the 248th military training ground in Knyazye-Volkonskoye, Khabarovsk Krai; and the 249th military training ground in Primorsky Krai. The GUR reported that the Russian military spent several weeks coordinating with the North Korean military units. The GUR reported that North Korea has transferred roughly 12,000 North Korean personnel, including 500 officers and three generals, to Russia and that Russian Deputy Defense Minister Colonel General Yunus-Bek Yevkurov is responsible for overseeing the training and adaptation of the North Korean military personnel. The GUR noted that the Russian military is providing ammunition and other personal kit to the North Korean personnel. Russian President Vladimir Putin responded to a question at a press conference after the BRICS summit in Kazan, Republic of Tatarstan, regarding recently released South Korean intelligence satellite imagery reportedly showing North Korean troops in Russia.[2] Putin wryly responded that “photos are a serious thing” and “reflect something.”[3] Putin reiterated the mutual defense article in the Russian-North Korean strategic partnership agreement with North Korea, announced in June 2024 and officially ratified by the Russian State Duma on October 24, 2024.[4]

Belarusian President Alexander Lukashenko strongly hinted that Belarusian forces will not fight in Ukraine and appeared to question Russian President Vladimir Putin's likely efforts to introduce North Korean forces into Russia's war against Ukraine in the process. Lukashenko answered a question from the BBC on October 23 about reports of North Korean troops going to fight alongside Russian forces in Ukraine, claiming that these reports are “rubbish,” that Russian President Vladimir Putin would “never try to persuade” another state to involve its army in Russia's war in Ukraine, and that the deployment of armed forces from any state – including from Belarus – to the frontline in Ukraine would be a “step towards the escalation” of the war.[5] Lukashenko claimed that if “we” (Belarussians) got involved in the war, this would be the “path to escalation” and that NATO would deploy forces to Ukraine in response to another country's involvement. Lukashenko continued to deny that Belarus was involved in the Russia's launch of its full-scale invasion of Ukraine in part from Belarussian territory. Lukashenko also gave an interview on October 23 to Russian state-run TV channel Rossiya 1 in which he claimed that he did not think that the Russian leadership or military needs North Korean troops as there are enough Russian forces on the front and Russia has significant mobilization resources.[6] Lukashenko claimed that Moscow understands that the deployment of North Korean forces to the war would be “undesirable for Russia” and that the West will respond by sending NATO troops to Ukraine. Kremlin newswire TASS notably did not report on Lukashenko’s statements about how the use of North Korean forces in Russia's war against Ukraine is not in Russia's interests and only reported on his claims that NATO would deploy troops to Ukraine in response to the participation of North Korean forces in the war.[7]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-24-2024

7,550 posted on 10/24/2024 11:25:26 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7506 | View Replies]

1630/24/60 = 1.13 i.e. more than one Russian soldier per minute.


7,551 posted on 10/24/2024 11:31:30 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7507 | View Replies]

To: PIF
Russian blogger:

Belousov and Gerasimov were accused of deceiving Putin. The military has three questions at once

After Vladimir Putin's press conference following the BRICS summit, many military personnel contacted us – both generals and combat officers who are fighting on different sections of the front. They had a number of questions about the president's statements. The military suspects that Andrei Belousov and Valery Gerasimov are “brazenly deceiving Vladimir Vladimirovich, giving him false information about the situation on the battlefield.” “There is no other way to explain it. Such deception must stop, otherwise there will be trouble,” an officer who is currently fighting in the Kursk region told us.

The military had three main questions. First, they refuted the president's statement that about 2,000 Ukrainian Armed Forces soldiers are surrounded in the Kursk region. “The information is not true, the situation in the Kursk region is constantly changing, today we are bringing them down, tomorrow they are bringing us down. We will win, but why run ahead of the locomotive? “Let's not forget the bloodshed that goes into liberating the region,” said a military man who is currently in the Kursk region.

We would like to point out that we called on the Defense Ministry not to lie about non-existent successes in the region, as this way we are belittling real successes. Unfortunately, we were not heard. And the president was also set up.

Secondly, many were surprised by Putin's words that “there were no drone strikes on Russian territory before the start of the military operation, but the situation was much worse.” “It seems that Vladimir Vladimirovich was told that all important facilities in Russia are protected by air defense. I am desperate, to be honest, and I want this deception against the president to end as soon as possible. And it is better without drone strikes than with them,” noted one of our sources.

Thirdly, a number of military personnel consider it superfluous to say that NATO is directly involved in the Ukrainian war against Russia. “A very strange statement. We are essentially admitting that we cannot respond to the West's aggression in any way. NATO will see this and simply stop being afraid of us! And what next? Western missiles at Moscow? It would be good to punish the one who advised Vladimir Vladimirovich to say such dangerous things that are better left unsaid,” one of the generals who contacted us was indignant.

At the same time, it should be noted that the military also saw very positive aspects in the president's speech: almost all of our interlocutors were pleased that Putin made a statement regarding the possible participation of DPRK troops in the SVO [invasion of Ukraine]. “Vladimir Vladimirovich showed strength to the entire NATO. And what about NATO, the entire world. Let them think about it now,” one of the generals who contacted us believes. Incidentally, the military refused to comment on Putin's statements regarding readinessto the negotiations on Ukraine. They said that this is politics and none of their business.

Sources in the Ministry of Defense and the General Staff in conversations with us said that they “never deceived Vladimir Vladimirovich .” And that the military who make such accusations “simply do not have all the information about the Ukrainian conflict.” The Kremlin, however, has so far refused to comment on the situation.

https://t.me/kremlin_secrets/4817

7,552 posted on 10/24/2024 11:39:22 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7551 | View Replies]

To: SpeedyInTexas

U.S. Pushes Back On Claim Israel Delaying Iran Attack Over Document Leak
Israel has vowed to retaliate strongly against Iran for Iran’s ballistic missile barrage and there are no firm signals it intends to back off
https://www.twz.com/news-features/u-s-pushes-back-on-claim-israel-delaying-iran-attack-over-document-leak


7,553 posted on 10/25/2024 4:09:07 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7540 | View Replies]

To: SpeedyInTexas

Russians Helped Houthis Target International Shipping: Report
The Houthis’ anti-shipping campaign diverted a lot of attention from Russia’s war in Ukraine.
https://www.twz.com/news-features/russians-helped-houthis-target-international-shipping-report


7,554 posted on 10/25/2024 4:09:55 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7540 | View Replies]

To: ETCM

The soldiers moved this month and are being trained at multiple Russian military bases, Kirby said.


From reports, the training consists mainly of dodging ball bearings ...


7,555 posted on 10/25/2024 4:16:10 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7549 | View Replies]

To: SpeedyInTexas

Breitbart reports:

“Blue Miami-Dade county in Florida flipped from Democrat to Republican in early and mail-in voting combined Thursday afternoon, according to the latest election results.”...

...”This development, for Miami-Dade is significant and follows the county flipping red in the 2020 election, going for both Gov. Ron DeSantis and Sen. Marco Rubio (R-FL).

It also coincides with the reality that Republicans now have over one million more registered voters than Democrats in the Sunshine State. For the first time ever, in November 2021, registered Republicans outnumbered registered Democrats in the Sunshine State, and the figure has only continued to grow.”


7,556 posted on 10/25/2024 5:53:56 AM PDT by BeauBo
[ Post Reply | Private Reply | To 7494 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians Caught Off Guard. Ukrainians Secure Supply Lines and Thwarts Russian Attacks ]


Today [ Oct 25 ], there are a lot of updates from the Lyman direction.

Here, in a decisive move, the Ukrainian command redeployed elite forces to stabilize the situation near Nevske, countering a significant Russian push. This swift maneuver enabled a successful counterattack, allowing Ukraine to regain control of key positions and blunt the Russian advance toward Torske.

Recent developments in the Lyman direction have shown significant intensification of Russian efforts, particularly focused on advancing through the Terny-Torske area. The Russian strategic objective remains clear: crossing the Zherebets river to capture Lyman, a critical railway and logistics hub.

This objective holds particular significance as Lyman would be essential for any Russian further advancement toward Sloviansk and Kramatorsk, the two major Ukrainian-held cities in the Donbas region. Since abandoning their Kyiv offensive in 2022, taking full control of Donbas has become Russia’s primary political and military objective.

If we look at the topographic map, we can observe that only 2 main vectors are available for Russian forces advancing toward Lyman, as the southern area through the Serebryansky forest is basically blocked due to the dense woodland, thus making mechanized advances there nearly impossible.

The first viable option follows a route from Torske and Zarichne, avoiding wide water bodies and elevated terrain but running dangerously close to the forest’s northern edge.

The second option involves crossing the Zherebets River near Terny and Yampolivka. While this route initially faces challenges in the form of wide water areas and elevated terrain beyond the river, a successful advance here would provide the crucial advantage of approaching Lyman from higher ground.

In any case, Russian forces have adopted a wide approach, recognizing that success at Terny and Yampolivka could significantly improve their tactical position near Torske. This strategy has also led to recent increased bombardment, particularly with FAB bombs concentrated around Terny.

After numerous failed frontal assaults near Terny and Yampolivka, Russian forces adjusted their approach, launching a surprise attack further north to capture Nevske. While Nevske’s geographical position in the lowlands makes it unsuitable for amassing forces for a significant southward push, its capture served two purposes: disrupting Ukrainian logistics to supply the Ukrainian bridgehead and diverting Ukrainian resources away from sectors in the south.

The Ukrainian command demonstrated an accurate tactical understanding in response to this situation. Elements of the different elite units, including the 3rd Assault Brigade, were rapidly redeployed from their positions 12 kilometers north to launch a counterattack at Nevske.

Recent first-person footage from this operation revealed intense clashes and dramatic scenes as soon as Ukrainian soldiers dismounted from M113 armored personnel carriers and stormed Russian positions, first in forested areas and then in Nevske village itself. Among other interesting details, the footage highlights the extensive use of drones in commanding and directing Ukrainian assaults, showcasing their technological integration in tactical operations.

A particularly shocking episode unfolded during a close-quarters encounter inside a Nevske building. Ukrainian soldiers, during a brief rest, detected enemy presence just meters away, leading to an intense firefight where their superior reaction time proved decisive.

As a result, the successful undermining of Russian operations in Nevske allowed Ukrainian forces to more effectively concentrate resources against Russian attacks near Torske.

Geolocated footage from the 60th Mechanized Brigade’s drone operators in Nevske documented successful strikes against Russian tank crews and infantry from the 37th Motorized Rifle Regiment and 19th Tank Regiment. These precision drone attacks east of Torske village demonstrated the continuing effectiveness of Ukrainian drone warfare in this sector.

Overall, the Ukrainian commenced rapid deployment of elite units like the 3rd Assault Brigade from their oppositions further north proved decisive this swift action enabled a lightning counterattack that stabilized the situation and reclaimed significant portions of Nevske.

Most importantly, this success allowed Ukrainian forces in the southern sector to focus more effectively on repelling Russian attempts to advance toward Torske.

This recent series of engagements underscores the Ukrainian military’s ability to read and react to tactical situations quickly, deploying elite units precisely where needed while maintaining effective drone and artillery coordination across multiple sectors.

The Russian attempt to create a diversion at Nevske, while initially successful, ultimately failed to achieve its broader strategic objectives due to the rapid and decisive Ukrainian response.


7,557 posted on 10/25/2024 6:02:35 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7556 | View Replies]

To: PIF; SpeedyInTexas
The Central Bank raised the key rate by two percentage points at once. From now on, it is 21% — an absolute record of this century. The previous maximum of 20% was reached in February 2022, after the start of the SVO [invasion of Ukraine] and the freezing of the Central Bank's reserves.

The Bank of Russia explains its decision as follows:

Inflation expectations continue to increase.
The growth of domestic demand significantly outpaces the ability to expand the supply of goods and services.
Additional budget expenditures and the associated expansion of the federal budget deficit in 2024 have pro-inflationary effects.

At the same time, the Central Bank speaks of the need for further tightening of monetary policy in order to ensure inflation returns to the target and reduce inflation expectations. In its release, the regulator allows for the possibility of raising the key rate at the next meeting, which will take place on December 20.

https://www.bfm.ru/news/560667

We can assume that the Russian inflation > 21 % (interest rate)

7,558 posted on 10/25/2024 6:18:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7557 | View Replies]

To: BeauBo
oofa


7,559 posted on 10/25/2024 7:12:00 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7556 | View Replies]

To: gleeaikin

The Putinistas here pretend everything wrong in Europe is via “neocon” meddling, which is exactly what the thinkers around Putin want people in the west to believe.


7,560 posted on 10/25/2024 7:24:31 AM PDT by Wuli
[ Post Reply | Private Reply | To 7534 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,521-7,5407,541-7,5607,561-7,580 ... 21,001-21,005 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson