Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians Caught Off Guard. Ukrainians Secure Supply Lines and Thwarts Russian Attacks ]


Today [ Oct 25 ], there are a lot of updates from the Lyman direction.

Here, in a decisive move, the Ukrainian command redeployed elite forces to stabilize the situation near Nevske, countering a significant Russian push. This swift maneuver enabled a successful counterattack, allowing Ukraine to regain control of key positions and blunt the Russian advance toward Torske.

Recent developments in the Lyman direction have shown significant intensification of Russian efforts, particularly focused on advancing through the Terny-Torske area. The Russian strategic objective remains clear: crossing the Zherebets river to capture Lyman, a critical railway and logistics hub.

This objective holds particular significance as Lyman would be essential for any Russian further advancement toward Sloviansk and Kramatorsk, the two major Ukrainian-held cities in the Donbas region. Since abandoning their Kyiv offensive in 2022, taking full control of Donbas has become Russia’s primary political and military objective.

If we look at the topographic map, we can observe that only 2 main vectors are available for Russian forces advancing toward Lyman, as the southern area through the Serebryansky forest is basically blocked due to the dense woodland, thus making mechanized advances there nearly impossible.

The first viable option follows a route from Torske and Zarichne, avoiding wide water bodies and elevated terrain but running dangerously close to the forest’s northern edge.

The second option involves crossing the Zherebets River near Terny and Yampolivka. While this route initially faces challenges in the form of wide water areas and elevated terrain beyond the river, a successful advance here would provide the crucial advantage of approaching Lyman from higher ground.

In any case, Russian forces have adopted a wide approach, recognizing that success at Terny and Yampolivka could significantly improve their tactical position near Torske. This strategy has also led to recent increased bombardment, particularly with FAB bombs concentrated around Terny.

After numerous failed frontal assaults near Terny and Yampolivka, Russian forces adjusted their approach, launching a surprise attack further north to capture Nevske. While Nevske’s geographical position in the lowlands makes it unsuitable for amassing forces for a significant southward push, its capture served two purposes: disrupting Ukrainian logistics to supply the Ukrainian bridgehead and diverting Ukrainian resources away from sectors in the south.

The Ukrainian command demonstrated an accurate tactical understanding in response to this situation. Elements of the different elite units, including the 3rd Assault Brigade, were rapidly redeployed from their positions 12 kilometers north to launch a counterattack at Nevske.

Recent first-person footage from this operation revealed intense clashes and dramatic scenes as soon as Ukrainian soldiers dismounted from M113 armored personnel carriers and stormed Russian positions, first in forested areas and then in Nevske village itself. Among other interesting details, the footage highlights the extensive use of drones in commanding and directing Ukrainian assaults, showcasing their technological integration in tactical operations.

A particularly shocking episode unfolded during a close-quarters encounter inside a Nevske building. Ukrainian soldiers, during a brief rest, detected enemy presence just meters away, leading to an intense firefight where their superior reaction time proved decisive.

As a result, the successful undermining of Russian operations in Nevske allowed Ukrainian forces to more effectively concentrate resources against Russian attacks near Torske.

Geolocated footage from the 60th Mechanized Brigade’s drone operators in Nevske documented successful strikes against Russian tank crews and infantry from the 37th Motorized Rifle Regiment and 19th Tank Regiment. These precision drone attacks east of Torske village demonstrated the continuing effectiveness of Ukrainian drone warfare in this sector.

Overall, the Ukrainian commenced rapid deployment of elite units like the 3rd Assault Brigade from their oppositions further north proved decisive this swift action enabled a lightning counterattack that stabilized the situation and reclaimed significant portions of Nevske.

Most importantly, this success allowed Ukrainian forces in the southern sector to focus more effectively on repelling Russian attempts to advance toward Torske.

This recent series of engagements underscores the Ukrainian military’s ability to read and react to tactical situations quickly, deploying elite units precisely where needed while maintaining effective drone and artillery coordination across multiple sectors.

The Russian attempt to create a diversion at Nevske, while initially successful, ultimately failed to achieve its broader strategic objectives due to the rapid and decisive Ukrainian response.


7,557 posted on 10/25/2024 6:02:35 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7556 | View Replies ]


To: PIF; SpeedyInTexas
The Central Bank raised the key rate by two percentage points at once. From now on, it is 21% — an absolute record of this century. The previous maximum of 20% was reached in February 2022, after the start of the SVO [invasion of Ukraine] and the freezing of the Central Bank's reserves.

The Bank of Russia explains its decision as follows:

Inflation expectations continue to increase.
The growth of domestic demand significantly outpaces the ability to expand the supply of goods and services.
Additional budget expenditures and the associated expansion of the federal budget deficit in 2024 have pro-inflationary effects.

At the same time, the Central Bank speaks of the need for further tightening of monetary policy in order to ensure inflation returns to the target and reduce inflation expectations. In its release, the regulator allows for the possibility of raising the key rate at the next meeting, which will take place on December 20.

https://www.bfm.ru/news/560667

We can assume that the Russian inflation > 21 % (interest rate)

7,558 posted on 10/25/2024 6:18:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7557 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson