Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,461-7,4807,481-7,5007,501-7,520 ... 21,021-21,028 next last
To: SpeedyInTexas; PIF

“The loan (with proceeds from frozen Russian assets) offers G7 nations a chance to lock in longer-term funding for Ukraine’s war effort”

Kyiv Independent reports that the G-7 now plans to hang on to those frozen Russian assets, until Russia settles reparations for its invasion (i.e., forever):

“The Group of Seven (G7) plans to keep Russian assets frozen even after the end of Russia’s war against Ukraine, the Japanese news agency Nikkei reported on Oct. 22, citing its undisclosed sources from G7.

European countries hold roughly two-thirds of the $300 billion in Russian sovereign assets immobilized after the outbreak of the full-scale war. While hesitant to confiscate the assets outright, the European Union has devised a plan to use windfall profits to fund Ukraine’s reconstruction and defense needs.

G7 leaders will issue a joint statement in October saying that “Russia’s sovereign assets will remain immobilized until Russia ends its aggression and pays for the damage it has caused to Ukraine,” according to the draft prepared by this year’s chair, Italy...

...Estimates of the damage that Russia’s aggression has caused to Ukrainian infrastructure over the past decade vary. The World Bank said in February that it could be as high as $486 billion.”


7,481 posted on 10/22/2024 2:48:04 PM PDT by BeauBo
[ Post Reply | Private Reply | To 7478 | View Replies]

To: gleeaikin

Considering Germany was dependent on Czech equipment esp tanks and armament industry for invasions of France and Soviet Union, not giving away someone else’s country would have been a start.

Sounds kind of familiar


7,482 posted on 10/22/2024 3:31:37 PM PDT by blitz128
[ Post Reply | Private Reply | To 7476 | View Replies]

To: BeauBo

7,483 posted on 10/22/2024 4:55:56 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7481 | View Replies]

To: JonPreston

Xi will turn on Putin when he has his chance, like Hitler turned on Stalin.

There is no honor among thieves.


7,484 posted on 10/22/2024 7:06:40 PM PDT by BeauBo
[ Post Reply | Private Reply | To 7483 | View Replies]

To: JonPreston

Who is in the center of that picture?

Says who is top dog and who is a lap dog.


7,485 posted on 10/22/2024 7:07:43 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7483 | View Replies]

Russian Offensive Campaign Assessment, October 22, 2024

South Korea may be considering directly sending weapons and intelligence personnel to Ukraine in response to the reported deployment of North Korean troops to Russia to participate in Russia's war in Ukraine. South Korea's Yonhap News Agency reported on October 22 that a South Korean government source stated that South Korea is considering sending South Korean military personnel, likely from intelligence units, to Ukraine to monitor North Korean forces’ tactics and combat capabilities and to question captured North Koreans.[8] The source also reportedly stated that South Korea will prioritize giving Ukraine defensive weapons over lethal aid but, if South Korea were to provide lethal weapons, Seoul will first try to find a way to provide them indirectly to Ukraine. South Korean National Security Director Chang Ho-jin stated on June 20 following the initial creation of the Russian-North Korean strategic partnership agreement on June 19 that the agreement had encouraged South Korea to change its long-standing policy prohibiting the transfer of arms to Ukraine, and Yonhap News Agency reported on June 21 that South Korea was considering sending 155mm artillery shells and unspecified air defense systems to Ukraine.[9] South Korea's continued consideration of sending lethal aid to Ukraine comes against the backdrop of threats from Russian President Vladimir Putin on June 20, when Putin stated that Seoul would be making “a very big mistake” if it decided to supply arms to Ukraine.[10]

Ukraine's Main Military Intelligence Directorate (GUR) Head Lieutenant General Kyrylo Budanov told The War Zone on October 22 that the first North Korean military personnel are expected to arrive in Kursk Oblast on October 23 but that it is unclear how large the force grouping will be or how they will be equipped.[11] Newsweek reported that a South Korean government official stated that North Korea sent fighter pilots to Vladivostok, Primorsky Krai in September 2024, possibly to train on Russian combat aircraft that Russia has allegedly supplied to North Korea, or to supplement Russia's pilot shortages.[12]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-22-2024

7,486 posted on 10/23/2024 6:36:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7464 | View Replies]


7,487 posted on 10/23/2024 6:38:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7429 | View Replies]

To: SpeedyInTexas

North Korean Troops Get Free Demonstration of Western Weapons

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Wiped Out on Day One. Ukrainians Strike NK Bases ]


Today [ Oct 23 ], there are a lot of updates from the Russian Federation.

Following heavy losses for modest territorial gains, Russian forces urgently needed to replenish their ranks. However, the Russian President rejected a new wave of mobilization, citing concerns over potential public unrest and a decline in popular support.

Facing limited alternatives, Russia sought additional assistance from its ally North Korea, which had already supplied thousands of artillery shells and ballistic missiles. This time, the request was for manpower. Aware of the significant threat that an influx of fresh troops could pose on the frontlines, Ukraine’s high command moved decisively to mitigate this emerging danger.

Over the past months, Russia has concentrated on engaging Ukrainian forces across multiple fronts to thin out their defenses and secure a key breakthrough. To bolster this effort, Russian forces opened a new front in the northern Kharkiv region in May. Nonetheless, this maneuver did not result in a major collapse of Ukrainian defenses.

In a bold and unexpected move, Ukrainian forces launched an offensive in Russia’s Kursk region, compelling Moscow to redeploy some of its most experienced units from Eastern Ukraine, thereby deepening the urgent need for additional troops.

Although Russia possesses vast manpower reserves, maintaining the current rate of losses without initiating a new wave of mobilization is becoming increasingly untenable. The government has attempted to attract recruits by significantly raising financial incentives, and focusing efforts on candidates from economically disadvantaged regions.

However, these measures may prove insufficient to meet the demands. A large-scale mobilization risks triggering widespread public unrest, potentially destabilizing the country, and emboldening factions eager to exploit growing anti-war sentiment to challenge the government’s hold on power.

Recruiting foreign combatants is not new for the Russian military, but it has mostly been informal, with promises of high pay or Russian citizenship. This is changing due to the close relationship between Russian President Vladimir Putin and North Korean leader Kim Jong-Un. Ukrainian officials recently warned of an agreement between the two nations, with military intelligence confirming that North Korean soldiers are already training in Russian camps, signaling their potential deployment.

Several Western leaders initially dismissed these claims, but the situation changed when South Korea’s National Intelligence Service publicly revealed that approximately 12,000 North Korean soldiers, including 1,500 special forces troops, had been transferred to Russian training facilities.

South Korean intelligence, working in coordination with their Ukrainian counterparts, used facial recognition artificial intelligence to identify North Korean officers operating in Ukraine’s Donetsk region. In an official statement, they declared, “The direct military cooperation between Russia and North Korea, previously reported by foreign media, has now been officially confirmed.”

The first video evidence confirming the presence of Korean units on Russian soil soon emerged from one of the training grounds, swiftly followed by footage showing them receiving equipment and Russian uniforms. These developments, along with numerous eyewitness reports connecting the presence of these troops to training facilities in Russia and Russian-occupied territories in Ukraine, prompted a rapid response from the Ukrainian side.

Reports surfaced of a nighttime drone strike targeting the Moscow Higher Combined Arms Command School near the Russian capital, with residents sharing geolocated footage of the aftermath. Such military infrastructure deep inside Russia plays a crucial role in training newly arrived North Korean troops, making it an attractive target for Ukrainian precision strikes. Intelligence indicates that the 12,000 North Korean soldiers are dispersed across multiple sites, prompting Ukraine to broaden its strikes to include military facilities along the front line.

Ukrainian operators deployed Shark surveillance drones to monitor enemy activity, identifying soldiers conducting training exercises in open fields. Seizing the opportunity, they targeted the troops during these maneuvers.

With drones in the sky relaying precise coordinates, a HIMARS strike was launched using rockets
equipped with cluster munitions. In a display of of thorough preparation the released footage from two separate drones underscoring their superior drone capabilities. The footage concluded with scenes of Russian emergency crews attempting to administer first aid to the wounded and retrieve the bodies of the fallen.

Overall, the deployment of North Korean troops to bolster Russian forces in Ukraine represents a
significant escalation in the conflict heightening the risk of broader global instability.

In response the Ukrainian military moved swiftly launching targeted strikes on training grounds and camps to neutralize the threat before it could materialize on the battlefield. As both sides adapt to the evolving situation the broader impact remains uncertain.

However, with the Ukrainian intelligence closely tracking the movements of North Korean units these strikes are likely to intensify, aiming to the reinforcements and potentially deter Kim Jong-Un from committing additional troops in the face of quickly mounting losses.


7,488 posted on 10/23/2024 6:46:43 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7485 | View Replies]

To: SpeedyInTexas
(one week anniversary)

BRICS is a'coming


7,489 posted on 10/23/2024 6:48:56 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7485 | View Replies]

With these losses, it will take less than 10 days before the North Korean contribution in manpower is exhausted.

7,490 posted on 10/23/2024 6:49:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7465 | View Replies]

To: JonPreston
As long as the US military continues to protect the border between North and South Korea, I'm ok with them fighting for The Zelensky


7,491 posted on 10/23/2024 7:15:23 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7489 | View Replies]

To: PIF; All
“The attackers in Turkey”






7,492 posted on 10/23/2024 8:03:37 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7491 | View Replies]

To: PIF; All
“Rs are killing it in Arizona as well”




7,493 posted on 10/23/2024 9:02:12 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7492 | View Replies]

To: PIF; All
The numbers out of Nevada mean, moving Nevada to R column.

My prediction 2 weeks out.


7,494 posted on 10/23/2024 9:04:53 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7493 | View Replies]

To: SpeedyInTexas

My prediction 2 weeks out. D 251 R 287


Add AK, PA and VA to the Dem column - D286 / R252

D 82,000,000 / R 51,000,000

Shows the power of 11.5 million new D voters.

Yes, they will successfully cheat once again. R response - same as in 2020. NADA. Harris gets to certify herself as President. Turning new page. Joy & hope abound in the MSN. First female President and of color. DEI and SJ become standard fare everywhere. Chinese becomes mandatory school language.

Rs get keep going to those big D parties and get favorable pieces in the MSN. Rs no longer have the pressure to “get something done” in the House or the Senate, since both will be D again. Blame will go to the MTG/Gaetz crowd - conservative wing completely discredited due to House shenanigans.

Steven Seagal moves back to US from Russia - declares US to be now better than Russia, a dream state, a real workers paradise.


7,495 posted on 10/23/2024 9:40:25 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7494 | View Replies]

To: PIF

“Add AK, PA and VA to the Dem column - D286 / R252”

I already have VA in D column.

No way Alaska goes D.

PA, yes it could go either way and would put Willie Brown’s mistress over the top.

Steven Seagal won’t fit in an airplane seat anymore to fly here. Might have to use a cargo plane.


7,496 posted on 10/23/2024 11:26:53 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7495 | View Replies]

To: SpeedyInTexas

For the life of me I cannot understand how anyone could vote for President someone who has done nothing, created nothing, lied about everything, and hates America.


7,497 posted on 10/23/2024 11:38:06 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7496 | View Replies]

To: AdmSmith; SpeedyInTexas; PIF; blitz128; FtrPilot; USA-FRANCE; BeauBo; freeandfreezing; Magnum44; ...

In the past hour, Scripps News featured US Sec. of Defense, Austin, stating that presence of Norks in Russia now seems to be confirmed. S Korea is now considering assistance to Ukraine, especially after Norks blew up their own rail line, and roads leading from the border between the 2 countries into Nork territory. While not ON S Korea territory, this destruction of cross border travel apparently IS IN VIOLATION of some existing agreement for travel and communication. Paints a definite picture of deterioration in already strained Nork/Sork relations. We still have troops in S Korea, and now it appears SK will return the favor by helping our friends in Ukraine.

Glad to see that Ukraine is already making life unpleasant for the lucky(?) Norks who thought life might be better serving in Russia. Perhaps more food since Russia has announced a full potato crop. Sad to think they are so far down a potato meal represents UP. Ah, the glories of communism and dictatorship.


7,498 posted on 10/23/2024 12:40:20 PM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 7490 | View Replies]

To: SpeedyInTexas

Kremlin snuff box, 10/23/24

Putin is pleased with the BRICS summit. But there are two things that ruined his mood

The BRICS summit in Kazan shows that Russia remains one of the world leaders, says Vladimir Putin. But two things related to this event, unfortunately, spoiled the President’s mood.

Firstly, Vladimir Vladimirovich was discouraged after his conversation with Xi Jinping [ https://t.me/rian_ru/266018 ].

“The Chinese leader asked a strange thing: when does our President think the fighting will end? And when will our army show strength, including in the Kursk region? Vladimir Vladimirovich was surprised by such questions, as they say, straight to the point. And he assured his Chinese colleague: Victory will be ours. At the same time, he promised to question the military with passion. They don’t give specific forecasts ( we wrote about this - ed. [ https://t.me/kremlin_secrets/4792 ] ),” a source close to Putin told us.

Secondly, Vladimir Vladimirovich is dissatisfied with the fact that Brazilian President Lula da Silva did not come to Kazan [ https://t.me/bbbreaking/192254 ]. “His injury is not that serious, it seems to me that such events should be missed. And here it would be very useful to us. An unpleasant incident,” Putin said about this.

In general, sources note that the summit is going well, despite some problems.


7,499 posted on 10/23/2024 1:14:38 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7496 | View Replies]

To: PIF

https://t.me/s/kremlin_secrets


7,500 posted on 10/23/2024 1:15:13 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7499 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,461-7,4807,481-7,5007,501-7,520 ... 21,021-21,028 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson