Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,441-7,4607,461-7,4807,481-7,500 ... 21,001-21,007 next last
To: AdmSmith

1,710!

Bloody day of Russian meat waves.


7,461 posted on 10/21/2024 4:19:36 PM PDT by BeauBo
[ Post Reply | Private Reply | To 7428 | View Replies]

To: PIF

Israel Iran strike leak:

“Both documents were widely accessible products, according to two sources familiar with US intelligence. But at least one appears to be scanned from an officially printed briefing book. That could provide investigators with a critical jumping-off point: The Defense Department, like other federal agencies, tracks when employees print classified documents. The pool of people who printed these pages would be relatively small, these sources said.”


7,462 posted on 10/21/2024 6:19:35 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7461 | View Replies]

To: SpeedyInTexas

“China is on track to become the largest market for Russia’s pipeline gas this year, overtaking Europe... that (27.3 bcm to China) is still (just a small) fraction (~1/6) of what the company (Gazprom) sent to Europe before Russia invaded Ukraine in 2022 (155 bcm).”

OilPrice.com reports:

“The EU’s natural gas storage is already at 95% full, data from Gas Infrastructure Europe show... as the heating season begins... Major economies and gas markets such as Germany and Italy have their storage at more than 97% full, while Austria, still dependent on Russian pipeline gas flows, had its gas storage at 93.73% full as of this weekend.”


7,463 posted on 10/21/2024 6:47:03 PM PDT by BeauBo
[ Post Reply | Private Reply | To 7438 | View Replies]

Russian Offensive Campaign Assessment, October 21, 2024

Moldova's October 20 European Union (EU) referendum passed by an extremely narrow margin in large part due to support from the Moldovan diaspora, and current Moldovan President Maia Sandu will face Alexandr Stoianoglo in a second round of voting on November 3. Several Moldovan and European officials reported potential Russian interference in the election, and the Kremlin and its affiliates in Moldova will likely continue their malign influence efforts in the leadup to the November 3 runoff. The Moldovan Central Election Commission (CEC) completed the vote count on October 21 and reported that 50.46 percent (751,235) voted in favor of the EU referendum and that 49.54 percent (737,639) voted against — a difference of only 13,596 votes.[1] The CEC reported that Sandu took first place in the presidential election with 42.45 percent (656,354) and Stoianoglo took second with 25.98 percent (401,726). Sandu failed to gain the majority vote required to win in the first round, and she and Stoianoglo will move to the second round. Moldovan authorities counted votes from polling stations abroad last, during which the number of votes in favor of the referendum and Sandu greatly increased. Sandu stated early on October 21 while Moldovan authorities were still counting votes that “criminal groups” and “foreign forces” — likely referring to Russia and Kremlin-linked Moldovan opposition politician Ilan Shor — used tens of millions of euros to spread propaganda to destabilize Moldova.[2] Sandu stated that Moldovan authorities have evidence that the criminal groups wanted to buy 300,000 Moldovan votes and that the scale of fraud was “unprecedented.” The European Network of Election Monitoring Organizations’ (ENEMO) International Election Observation Mission reported on October 21 that it found “massive malign foreign interference attempts” ahead of the October 20 election despite Moldovan authorities’ efforts to counter misinformation and vote buying schemes.[3] The BBC reported that it witnessed at least one instance of vote buying at a polling station in the pro-Russian breakaway Moldovan republic of Transnistria after a voter exited the poll and asked where she would receive her promised payment.[4] Moldovan authorities previously reported that Shor used a Russian state bank to distribute at least $15 million to Shor-affiliated regional leaders and voters in Moldova in September 2024 alone.[5]

Kremlin officials and Russian milbloggers claimed that Moldovan authorities falsified the results of the election and referendum and continued to promote long-standing Kremlin narratives targeting Moldova's path towards European integration. Russian Ministry of Foreign Affairs (MFA) Spokesperson Maria Zakharova claimed that Moldovan authorities used “totalitarian” methods during the election campaign and that the number of votes supporting the referendum “inexplicably” began to increase during the later stages of counting.[6] Zakharova claimed that the West is trying to turn Moldova into a “Russophobic NATO appendage deprived of sovereignty.” Kremlin Spokesperson Dmitry Peskov accused Moldovan authorities of persecuting opposition forces and claimed that Russian authorities are monitoring the allegedly questionable increase in the number of votes for Sandu and in support of the referendum.[7] Several Russian milbloggers, including Kremlin-affiliated milbloggers, claimed that Moldovan authorities falsified the election results and adjusted the referendum's voter turnout numbers.[8] One milblogger called for Russian authorities to create a network of “analytical and information centers” that will study how to influence processes in Moldova and promote Russia's state interests in Russia.[9]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-21-2024

7,464 posted on 10/21/2024 11:00:45 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7427 | View Replies]


7,465 posted on 10/21/2024 11:27:37 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7428 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Retake The Initiative from Russian Hands In Belgorod-Kharkiv ]


Today [ Oct 22 ], there are a lot of interesting updates from the Kharkiv direction.

In an effort to break the stalemate in this region, Russian forces attempted a new approach, launching coordinated assaults from multiple unexpected directions, to break Ukrainian defenses. However, the operation quickly faltered, and seizing the moment, Ukrainian forces took control of the battlefield, launching a successful series of counterattacks that not only regained key positions, but also shifted the momentum in their favor.

The main objective of Russian forces here is to capture Lyptsi. To achieve this, they opened a new assault vector from Zhuravlivka, complementing their initial push from Hlyboke. This new advance follows the E105 highway toward Velyki and Maly Prokhody, around 10 kilometers from the border. Securing these settlements would enable the Russians to attack Lyptsi from the west.

Meanwhile, northern forces are preparing to resume their assault, aiming to close within 3 kilometers of the village. This would pressure Lyptsi from both the north and west to overwhelm Ukrainian defenses.

The Russian 155th Marine Brigade was tasked with opening a new assault vector at Zhuravlivka, deploying stormtroopers aboard BMP-2s in preparation for a mechanized offensive. However, Ukrainian drone operators quickly intercepted the Russian marines, as they attempted to advance across the border. The drones effectively wiped out an entire assault platoon, destroying three BMP-2s, along with the marines who tried in vain to escape the strikes.

North of Lyptsi, Russian mechanized units, advancing with BMPs and turtle tanks under drone cover, became prime targets for Ukrainian drones. A Ukrainian FPV drone hit the lead tank in the column, halting its progress, and forcing the rest of the convoy to retreat in an attempt to avoid further destruction.

With Russian paratroopers neutralized, the remaining forces in the area consisted of regular troops. These positions were repeatedly struck by Ukrainian drones to prevent the buildup of stormtroopers for future assaults.

Following the failed Russian assaults, Ukrainian forces seized the opportunity to counterattack, targeting the disorganized Russian marines, retreating from drone strikes in Zhuravlivka. Under the cover of night, Ukrainian troops crossed the border through nearby forests, avoiding Russian detection.

Scattered to evade drones, the Russian marines were unable to mount a coordinated defense, allowing Ukrainian fighters to capture many of them. Belgorod Governor Vyacheslav Gladkov later confirmed that Ukrainian forces had launched a cross-border raid near Zhuravlivka.

In the Lyptsi area, Ukrainian forces ramped up drone strikes on Russian positions to the north. To maximize the effectiveness of these attacks, Ukrainian drone operators outfitted their drones with high-explosive bombs, napalm, and larger 6-kilogram incendiary bombs. These intensified strikes successfully saturated and weakened the Russian defenses, preparing the ground for an imminent Ukrainian counterattack.

For the counterattack north of Lyptsi, Ukrainian Military Intelligence Special Forces, including the elite Kraken and Artan Regiments, were tasked with leading the assault. They first deployed reconnaissance drones to carefully survey Russian positions, followed by precise artillery strikes. This paved the way for Ukrainian Special Forces, who advanced rapidly in armored personnel carriers along the roads.

After dismounting, they engaged in close-quarters combat, leveraging their superior training and combat experience against the already weakened Russian troops, suppressed by earlier drone and artillery strikes. By the end of the operation, the Ukrainians had captured a key patch of forest, helping to stabilize the defense in this sector.

Overall, the Russians expected to achieve tactical surprise by suddenly launching the attack in a new direction, however, their assaults were timely spotted and engaged, undermining further development of the operation. Given that the Russian Northern Group of Forces in Kharkiv contributed most of their forces to Kursk direction, sustaining high losses during these assaults was a critical factor for the continuation of the operation.

Such heavy losses turned the tables enabling Ukrainians to retake the initiative successfully retake multiple positions and even cross the Russian border to conduct a raid campaign while Russians
struggled to scrubble (modern version: scrabble) for reserves to stabilize the situation.


7,466 posted on 10/22/2024 5:33:32 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7462 | View Replies]

To: PIF; All
Nevada Election update:

"The headline: Republicans lead statewide in Nevada after three days of early voting and mail ballot counting. This has not happened in a presidential year in The Reid Machine Era, which encompasses the races since 2008. This could signal serious danger for the Dems and for Kamala Harris here.

It's pretty easy to explain: The Clark firewall has all but collapsed (it's 4,500 votes) and the rurals are way overperforming their share of the electorate with what has been tabulated, nearly by 4 points -- almost all taken from Clark's share. The large mail ballot lead enjoyed by Dems has been erased and more by the GOP lead in in-person early voting.

The Rs lead by about 8,000 [6,000 AS OF THIS MORNING] votes statewide, or 3 percent. Here are two charts that show what is happening:

The Rs have a nearly 2-point turnout advantage, and nearly 250,000 votes have been cast. That's probably not too far from a fifth of the total vote.

It's too soon to call it a trend, but this was a huge day for Republicans in Nevada (they are ahead in Washoe now, too, erasing a deficit). A few more days like this, though, and the Democratic bedwetting will reach epic proportions.

Far from over, too early to call, lots of mail still to come, but if Dems don't build that Clark firewall..."

https://thenevadaindependent.com/article/the-early-voting-blog-2024
7,467 posted on 10/22/2024 8:56:30 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7460 | View Replies]

To: PIF; All

Next stop 3500.

Demilitarization, desatanization and denazification of RuZZia continues.

Tanks (3493, of which destroyed: 2431, damaged: 158, abandoned: 373, captured: 531)


7,468 posted on 10/22/2024 9:00:49 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7467 | View Replies]

To: PIF; All

Laugh, Laugh, Laugh

https://x.com/Maks_NAFO_FELLA/status/1848460517502804002


7,469 posted on 10/22/2024 9:06:10 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7468 | View Replies]

To: PIF; All

“The European Parliament approves a €35 billion loan to Ukraine from frozen Russian assets.

The decision was supported by 518 deputies, 56 were against, and 61 abstained.

The funds will be disbursed by the end of 2025.”

https://x.com/wartranslated/status/1848691073284972548


7,470 posted on 10/22/2024 9:08:36 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7469 | View Replies]

To: PIF; All

Just Kill Em

“There is further evidence of North Korean military presence in Russia’s Primorsky Krai. ASTRA geolocated a video showing the alleged arrival of North Korean soldiers at military base 44980, part of the 127th Motorized Rifle Division in Sergeevka. The video’s narrator, speaking in Yakut, refers to the soldiers as “allies” and expresses hope the war will end soon.”

https://x.com/wartranslated/status/1848647091502854333


7,471 posted on 10/22/2024 9:10:36 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7470 | View Replies]

To: PIF; All

Second Army of the Universe

“Reports suggest North Korea has sent fighter pilots to Russia to potentially assist in the Ukraine war, amid shortages of Russian pilots according to Newsweek. South Korean media indicated that North Korean pilots were dispatched to Vladivostok ahead of ground troop deployment.”

https://x.com/NOELreports/status/1848731851084472379


7,472 posted on 10/22/2024 9:14:08 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7471 | View Replies]

To: PIF; All

so many drones, so little time

https://x.com/GloOouD/status/1848734938540990727


7,473 posted on 10/22/2024 9:20:58 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7472 | View Replies]

To: PIF; All

“Ukrainian pilots complete their training in the UK

Ukrainian Ambassador Valeriy Zaluzhnyi took part in the graduation ceremony of the 3rd cohort of Air Force pilots. He thanked the United Kingdom for its continued support of Ukraine, which is why we continue to fight”

https://x.com/Heroiam_Slava/status/1848755777999184349


7,474 posted on 10/22/2024 9:23:59 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7473 | View Replies]

To: PIF; All

“South Korea is now considering to send 155 mm artillery shells to Ukraine in response to North Korea sending thousands of soldiers to fight against Ukraine”

https://x.com/visegrad24/status/1848444233839219011


7,475 posted on 10/22/2024 9:27:05 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7474 | View Replies]

To: FtrPilot; AdmSmith; SpeedyInTexas; PIF; blitz128; tlozo; BeauBo; Monterrosa-24; USA-FRANCE; ...

Thanks for answering my earlier question about how S Korea might respond to Russia putting Norks to fight in Russia’s Kursk area, and possibly even into actual Ukraine territory.

I checked out the link provided. There was a very large number of comments, mostly approving the SK plan to assist and congratulating SK for having more guts than NATO and the US in their response. Only a few seemed to realize that NK and SK are still in a state of war after 70 years from the war my late husband fought in. A few years before he died we were buying groceries and speaking with the Korean store owners. When I mentioned my husband had served in the Korean War, they thanked him with great enthusiasm and gratitude for his effort to help their country.

This entire war situation is looking more and more like the Spanish Civil War where Germany and Russia tested their war materiel preparatory to their planned aggression against Poland, with the West offering token support, and then ending up in devastating WW2 for 6 years. Would a more robust response by the West have nipped WW2 in the bud, or would it have started that war a few years sooner???


7,476 posted on 10/22/2024 10:08:35 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 7459 | View Replies]

To: SpeedyInTexas

Kremlin snuff box, 10/22/24
https://t.me/s/kremlin_secrets

Russian officers will have to learn Korean

New rumors began to circulate at the front about the possible participation of military personnel from the DPRK in the Northern Military District.

Rumor has it that officers of the Russian Armed Forces will soon have to urgently learn the basics of the Korean language. Let us immediately note that there is currently no reliable information that such a decision has been or will be made.

However, the issue of communication between our military personnel and partners from North Korea was named among the main problems of the massive involvement of military personnel from the DPRK in combat operations. Some officers in Kim Jong-un’s army know Russian, but their actual number is small.

The use of translators is excluded, as this will significantly slow down the speed of decision-making at the front. It is expected that a basic dictionary will be created for Russian officers. Its study should take no more than a week and it will be issued to the military in a printed version. Junior and senior officers will need to know Korean.


7,477 posted on 10/22/2024 10:20:05 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7472 | View Replies]

To: PIF; All

Another $20 billion for the good guys.

“Treasury Secretary Janet Yellen said Tuesday that the U.S. was “very close” to finalizing a $20 billion contribution to a broader loan package to Ukraine that will be repaid from the income generated by frozen Russian assets.

“We’re 99 percent there and it’s nailing down just a couple of relatively small things,” Yellen told reporters. “We are very close.”

The U.S. and its allies have been trying to iron out the details of the $50 billion loan package since leaders reached an agreement at the G7 meeting in June. The deal, which came after Yellen and other Biden administration officials rallied sometimes reluctant allies around the idea, anticipated that Ukraine would receive the money by the end of the year. Yellen said that was still the goal.

The loan offers G7 nations a chance to lock in longer-term funding for Ukraine’s war effort and insulate the money from the outcome of the U.S. presidential election. Former President Donald Trump and many Republicans have been deeply skeptical of sending further U.S. assistance to Ukraine.

The European Parliament on Tuesday moved ahead with approving its own contribution to the loan of roughly $38 billion, though that share is expected to decrease with the U.S. allocation to the loan. The UK separately approved its contribution of about $3 billion.

The EU moved ahead to approve its participation in the loan without the U.S. as the Biden administration sought greater EU assurances that the Russian assets — the vast majority of which are frozen in Europe — would stay immobilized for a longer period of time. The concern was that the freeze on the assets could be ended before the G7 loan was repaid.

The EU currently needs a unanimous vote every six months to renew the sanctions that keep the Russian state assets blocked. But Hungary, whose leader Viktor Orbán is a Trump supporter and sympathetic to Russian President Vladimir Putin, had blocked changes to the EU sanctions regime that the U.S. was seeking.

Yellen said that even without those changes, U.S. officials feel confident that they can provide a $20 billion contribution to the broader $50 billion loan package.

“We have a high degree of confidence that the money will be there and will remain locked down,” Yellen said. She said the asset freeze is one component of a broader sanctions program, which she said would be “inconceivable” for any EU member to terminate while Russia’s invasion of Ukraine continues.

“The assurances are already there,” Yellen said. “We asked for some modest strengthening but feel good that this is a secure loan that will be serviced by Russian assets — by Russia and not by American taxpayers.””


7,478 posted on 10/22/2024 1:13:58 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7477 | View Replies]

To: SpeedyInTexas

this is a secure loan that will be serviced by Russian assets - by Russia and not by American taxpayers.


FR’s Pro-Putin trolls hardest hit.


7,479 posted on 10/22/2024 1:41:52 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7478 | View Replies]

To: PIF

Kyiv Independent reports that Putin and Xi talked for an hour at BRICS:

Russian President Vladimir Putin and his Chinese counterpart Xi Jinping discussed Ukraine during their meeting on Oct. 22 at the BRICS summit in Kazan, Russia.

The BRICS alliance, a bloc of countries that now includes Brazil, Russia, India, China, South Africa, Iran, Egypt, Ethiopia, and the United Arab Emirates, is convening in Kazan for a three-day summit from Oct. 22-24. According to Moscow, 36 world leaders are participating in the conference.

Putin and Xi reportedly spoke for about an hour, according to Russian state media. The leaders discussed Russia’s war against Ukraine, the BRICS agenda, and bilateral relations.

“The world is undergoing profound changes unseen in a century, and the international situation is chaotic and intertwined,” Xi said.

Xi and Putin during their meeting “outlined the main parameters of further contacts to continue the dialogue,” according to Kremlin spokesperson Dmitry Peskov...

...President Volodymyr Zelensky said on Oct. 17 that intelligence data indicates that “China is actively helping Russia drag out this war.””


7,480 posted on 10/22/2024 2:40:54 PM PDT by BeauBo
[ Post Reply | Private Reply | To 7477 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,441-7,4607,461-7,4807,481-7,500 ... 21,001-21,007 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson