Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,101-7,1207,121-7,1407,141-7,160 ... 19,301-19,312 next last
To: JonPreston
JonPreston: "There is only one reason that Volodymyr Zelensky is asking for a ceasefire now.
He knows the honeypot is about to come to an end."

All this kind of talk is pure Russian propaganda.
Here is the real story:

"Zelenskyy clarifies whether ceasefire talks are underway in exchange for Western guarantees Thu, October 10, 2024 - 20:46

Ukraine is not considering a ceasefire to obtain guarantees from the West.
Russia may be spreading fake news about such concessions in the media, stated Ukrainian President Volodymyr Zelenskyy after the meeting with French President Emmanuel Macron.

Rumors about a ceasefire:
The head of the Ukrainian state was asked whether Ukraine is considering a ceasefire if it receives guarantees from Western countries.

'This is not a topic of our discussion with other allies, we didn't speak about it.
I saw in the media something.
Russia works a lot with media, with disinformation, so it's understandable,' said the President."

Zelensky has always opposed a ceasefire because:
"Ukraine’s Zelenskyy rules out cease-fire with Russia, argues Moscow would use it to rearm and regroup"
Zelensky & Macron meeting, October 10, 2024:

7,121 posted on 10/12/2024 2:14:52 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 7107 | View Replies]

To: marcusmaximus

“Donald Trump doesn’t know how to stop the war in Ukraine & JD Vance is dangerous and too radical” - V. Zelensky, Sep.2024”


7,122 posted on 10/12/2024 3:04:31 AM PDT by ANKE69 (✌️🇺🇲)
[ Post Reply | Private Reply | To 7118 | View Replies]

To: PIF; All

Russian Su-34 shot down by Ukrainian F-16 near Donetsk.


7,123 posted on 10/12/2024 3:56:57 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 7119 | View Replies]

To: BroJoeK
excuse me you Neocon, I didn't order this


To: JonPreston
JonPreston: "There is only one reason that Volodymyr Zelensky is asking for a ceasefire now.
He knows the honeypot is about to come to an end."

All this kind of talk is pure Russian propaganda.
Here is the real story:

"Zelenskyy clarifies whether ceasefire talks are underway in exchange for Western guarantees Thu, October 10, 2024 - 20:46

Ukraine is not considering a ceasefire to obtain guarantees from the West.
Russia may be spreading fake news about such concessions in the media, stated Ukrainian President Volodymyr Zelenskyy after the meeting with French President Emmanuel Macron.

Rumors about a ceasefire:
The head of the Ukrainian state was asked whether Ukraine is considering a ceasefire if it receives guarantees from Western countries.

'This is not a topic of our discussion with other allies, we didn't speak about it.
I saw in the media something.
Russia works a lot with media, with disinformation, so it's understandable,' said the President."

Zelensky has always opposed a ceasefire because:
"Ukraine’s Zelenskyy rules out cease-fire with Russia, argues Moscow would use it to rearm and regroup"
Zelensky & Macron meeting, October 10, 2024:

7,121 posted on 10/12/2024 2:14:52 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 7107 | View Replies | Report Abuse]

7,124 posted on 10/12/2024 4:17:39 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7121 | View Replies]

To: PIF; All


7,125 posted on 10/12/2024 4:32:23 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 7119 | View Replies]

To: BroJoeK

It is fascinating that the usuals here scream ZEEPERS invading FR with spam, send out their tired memes and juvenile comments and the proceed to spam a thread that isn’t even on the current thread page.

And when you reply to their “comments” they respond with “I didn’t order this”

Amazing


7,126 posted on 10/12/2024 4:34:44 AM PDT by blitz128
[ Post Reply | Private Reply | To 7121 | View Replies]

To: marcusmaximus

Impossible, I heard from all the usuals that all the F-16s were destroyed
Pure propoganda. If glorious Russian aircraft was lost I am sure it was due to technical failures or falling debris/s😎


7,127 posted on 10/12/2024 4:38:39 AM PDT by blitz128
[ Post Reply | Private Reply | To 7123 | View Replies]

To: blitz128

The Russian Su-34 was dropping glide bombs when it was shot down by the Ukrainian F-16.


7,128 posted on 10/12/2024 4:43:23 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 7127 | View Replies]

To: marcusmaximus

Translation:

Fighterbomber
Earth sky, brothers... © 12.6K 11:09

L VDV for Honesty and Justice Urgently!!!

Our Su-34 was shot down. The crew died. The plane was shot down during the Dumping of the FAB from the UMPC, about 50 km from the front line. Our Su-34 was shot down by an apparently F-16, which was above the territory controlled by the enemy.

Soon there will be more such losses. NATO launched the F-16 for hunting.

Now there will be fewer FABs on Khokhlas. Consequently, the losses of our infantry will increase.


7,129 posted on 10/12/2024 4:57:05 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7125 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainian Forces Blow UP Entire Residential Area With Russians Inside ]


Today [ Oct 12 ], here are a lot of updates from the Toretsk direction.

Here, the Ukrainians launched a series of powerful counterattacks to prevent Russians from accumulating forces in the high-rise district of the city, setting the stage to cancel Russian assaults in the central part of Toretsk.

As the main Russian offensive effort to cut the Ukrainian defense of the city in half was halted, the Ukrainians took the opportunity to convert the central part of the city into a kill zone.

After securing the southern part of the high-rise building district, Russian stormtroopers were assigned to capture the northern section of this residential area. Gaining control of all the high-rise buildings in Toretsk would enable the Russians to establish fire control over the entire town.

This would set the stage for an offensive along the city’s Central Street, effectively splitting the Ukrainian defense into 2 isolated pockets.

However, the Ukrainians, aware of this plan, are continuously launching raids and counterattacks on Russian positions in the high-rise buildings to prevent their forces from massing for an assault. Their goal is to eliminate concentrations of Russian fighters by deploying the Lyut Special Purpose Assault Brigade, one of Ukraine’s most elite units.

These attacks aim to overwhelm the inexperienced Russian stormtroopers, who become trapped inside the high-rises by Ukrainian FPV drones. Additionally, the constant raids disrupt Russian efforts to establish fire positions, as the Lyut Brigade relentlessly assaults them.

The first phase of Ukrainian operations in the high-rise district involves deploying various drones to observe and strike Russian forces around the buildings. Combat footage from the area shows two Russian soldiers attempting to enter a building through its windows to minimize exposure to Ukrainian drones.

One of the soldiers struggled to get through the window and became stuck, making him an easy target for a swift Ukrainian FPV drone strike. Drone activity is so intense that Russian soldiers are struck as soon as they peek out of the windows, with Ukrainian drone operators immediately spotting and targeting them.

Because of this, Russian soldiers are trying to stay and hide inside the high-rise buildings for as long as possible, in fear of becoming another victim of a drone strike. This prevented them from enforcing fire control or observing the surrounding area, which enabled the Ukrainian stormtroopers to approach and enter the buildings.

Combat footage from the area highlights the intensity of Ukrainian raids on the high-rise buildings. Ukrainian stormtroopers advance swiftly on foot toward the entrances to avoid detection by nearby Russian forces. Once inside, each soldier covers specific hallways or corners where Russian troops might be positioned.

After clearing the hallways and ensuring no Russian presence, the Lyut Assault Brigade fighters move to the upper floors. By cutting off the Russian troops there, they proceed to eliminate them while they are trapped in firing positions inside the apartments. Following a successful raid, the Ukrainian stormtroopers exit the building.

Another group of Ukrainian stormtroopers approached a Russian-controlled building in an armored vehicle. While the vehicle’s machine gunner suppressed Russian forces to prevent them from returning fire, the Ukrainian stormtroopers cautiously entered the building.

Rather than engaging in a brutal close-quarters battle with potentially high casualties, the stormtroopers planted heavy explosives at key support walls. After exiting, they detonated the explosives, collapsing the entire building and killing dozens of Russian soldiers trapped inside.

Overall, the Ukrainians managed to trap the Russian fighters inside the high-rise buildings of Toretsk with high drone activity and set the stage to physically assault the isolated Russian forces inside, while also demolishing their firing positions. The continuation of Ukrainian drone strikes and raids could make the Russian positions in the high-rise area of central Toretsk completely untenable.

Simultaneously, the Ukrainian demolition squads could destroy Russian positions in these buildings and by demolishing them they would render all Russian operations for fire control of the area pointless.


7,130 posted on 10/12/2024 4:58:51 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7120 | View Replies]

Genius Russian Ambush | Karlivka & Synkivka Have Fallen | RUAF Reach Center of Selydove


7,131 posted on 10/12/2024 5:07:19 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7124 | View Replies]

To: BeauBo

Joe Blogs: RUSSIAN Ruble Crashing

https://www.youtube.com/watch?v=sE6Uvqr_Fbo


7,132 posted on 10/12/2024 5:33:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7115 | View Replies]

To: ANKE69

Do you have a link to that one sentence quote you posted?


7,133 posted on 10/12/2024 5:39:18 AM PDT by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 7122 | View Replies]

Russian Offensive Campaign Assessment, October 11, 2024

Chechen Republic Head Ramzan Kadyrov declared a “blood feud” against Russian legislators, suggesting that Kadyrov is becoming increasingly emboldened in his personal political disputes. Kadyrov declared a blood feud on October 10 against Republic of Dagestan Senator Suleiman Kerminov and State Duma Deputies Bekkhan Barakhoyev and Rizvan Kurbanov, claiming that they “seized” Russia's largest online retailer Wildberries from the company's co-founder Vladislav Bakalchuk and were plotting to assassinate Kadyrov.[28] Vladislav Bakalchuk, who co-founded Wildberries with his ex-wife and current Wildberries CEO Tatyana Bakalchuk, led 20 to 30 armed accomplices on simultaneous assaults of two Wildberries offices in Moscow City in September 2024.[29] Vladislav previously appealed to Kadyrov to help prevent Tatyana from taking over the company and claimed days before the September armed assaults that Kadyrov saved his life and kept him out of prison.[30] Kadyrov notably announced the blood feud in a video in the Chechen language on his Telegram channel but did not mention the feud specifically in the accompanying Russian text, likely in an attempt to prevent its reporting in Russian media.[31] Kadyrov has previously rhetorically attacked Kremlin officials, speaking out against Russian Investigative Committee Head Alexander Bastrykin’s June 2024 statements about religious extremism in Russia.[32] It is unclear if Russian President Vladimir Putin will respond to Kadyrov’s announcement of the blood feud, as Putin has supported Kadyrov’s rule over Chechnya but has consistently attempted to posture Russia as a harmonious multi-ethnic and multi-religious society.[33]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-11-2024

7,134 posted on 10/12/2024 5:40:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7093 | View Replies]

To: PIF
Russian blogger 12OCT2024:

Shooting of Center “E” employees in Ingushetia - the beginning of a big massacre in the Caucasus?

On Friday, October 11, on the federal highway at the exit towards the capital of Ingushetia, Magas, a car of Center “E” employees was shot at . Deputy head of Center “E” for the Republic of Ingushetia Adam Khamkhoev was in it. The attackers’ car was found burned nearby in North Ossetia. Three people died, Khamkhoev himself was not injured.

Despite the fact that this is far from the first attempt on Khamkhoev's life, this time it coincided with the aggravation of the situation in the Caucasus. We are talking about the conflict between Ramzan Kadyrov and Suleiman Kerimov, as well as State Duma deputies Bekkhan Barakhoev and Rizvan Kurbanov. At stake, as we wrote, is a lot of money. And Kadyrov put the Kremlin and the president personally in a difficult position because of the situation around Wildberries.

Sources in the security agencies hint that the assassination attempt on Khamkhoev may be connected to this case. They do not say how exactly, but they note that the danger for the representative of the Center “E” remains. And not only for him. “We are recording the movement of previously unnoticed groups that are connected to the Chechen elites. Their tasks are unknown to us. But activity has begun in the Caucasus. Including the de-mothballing of individual weapons depots that are assigned to units of the Russian Guard,” said a source in the Ministry of Internal Affairs, deeply informed about the situation. I would like to repeat my call to Ramzan Kadyrov - stop your intrigues. Yes, there is a lot of money at stake, but this can lead to a lot of bloodshed! In the face of external threats, no one needs such destabilization.

https://t.me/kremlin_secrets/4764

7,135 posted on 10/12/2024 5:45:56 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7134 | View Replies]


7,136 posted on 10/12/2024 5:48:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7065 | View Replies]


7,137 posted on 10/12/2024 5:50:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7094 | View Replies]

To: SpeedyInTexas

Back in 2002 Putin had no problem with Ukraine joining NATO‼️

“Ukraine is a sovereign state and has the right to choose the path to ensure its own security. I don’t see anything unusual here in principle. Or something that would spoil the relations between… Or could possibly spoil relations between Russia and Ukraine.”

- Vladimir Putin at NATO Summit Meeting in Rome, Italy (May 28, 2002)

https://x.com/NatalkaKyiv/status/1844559042691334237


7,138 posted on 10/12/2024 6:23:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7113 | View Replies]

To: JonPreston

“RUAF Reach Center of Selydove”

ITS OVER!


7,139 posted on 10/12/2024 7:42:28 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7131 | View Replies]

To: PIF; All

“Seems like Ukraine received AIM-9X air to air missiles. this is one of the most modern air to air missiles in the world.”

https://x.com/Teoyaomiquu/status/1844991670208823676


7,140 posted on 10/12/2024 7:45:56 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7139 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,101-7,1207,121-7,1407,141-7,160 ... 19,301-19,312 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson