Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,141-6,1606,161-6,1806,181-6,200 ... 20,961-20,974 next last
To: PIF; All

All Gone

“Satellite images obtained by Radio Svoboda show a completely destroyed Russian ammunition depot near the village of Soldatske in the Voronezh region”

https://x.com/NOELreports/status/1833592344702292460


6,161 posted on 09/10/2024 12:47:11 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6160 | View Replies]

To: SpeedyInTexas

Gave up on repubes some time ago, consider myself a constitutional conservative which leaves me largely homeless and unrepresented.


6,162 posted on 09/10/2024 12:47:17 PM PDT by blitz128
[ Post Reply | Private Reply | To 6158 | View Replies]

To: SpeedyInTexas

Consider the discounts, increased shipping costs it is much worse


6,163 posted on 09/10/2024 12:48:53 PM PDT by blitz128
[ Post Reply | Private Reply | To 6160 | View Replies]

To: PIF; All

“Important day tomorrow.

US Secretary of State and UK Foreign Secretary will visit Kyiv.

I hope tomorrow there will be a reason to post some good news here.”

https://x.com/Gerashchenko_en/status/1833592721166274561


6,164 posted on 09/10/2024 12:49:27 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6161 | View Replies]

To: blitz128

I’m a Reagan Republican.

Shunned by Trump Republicans.


6,165 posted on 09/10/2024 12:50:22 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6162 | View Replies]

To: PIF; All

Things keep on burning in RuZZiaLand

“A powerful explosion rang out in the blast furnace shop of the Russian metallurgical plant “Evraz NTMK”, located in Nizhny Tagil, Sverdlovsk region

One worker died, and three others were injured.

The company specializes in producing rolling stocks and train rails.”

https://x.com/PStyle0ne1/status/1833588845922930983


6,166 posted on 09/10/2024 12:54:22 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6165 | View Replies]

To: SpeedyInTexas

Modify Reagan’s line I didn’t leave the party the party left me


6,167 posted on 09/10/2024 2:07:44 PM PDT by blitz128
[ Post Reply | Private Reply | To 6165 | View Replies]

To: SpeedyInTexas

No love for Noxious Nixon or Reagan here. Both destroyed my profession and Reagan took away my job as tuna seiner skipper.


6,168 posted on 09/10/2024 3:04:43 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6165 | View Replies]

To: PIF

“tuna seiner skipper”

Had to google that.

I’m not often surprised here, but happens occasionally.


6,169 posted on 09/10/2024 3:27:34 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6168 | View Replies]

To: SpeedyInTexas

6,170 posted on 09/10/2024 3:33:33 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 6169 | View Replies]

To: JonPreston

RuZZia says no peace talks while Ukraine occupies Kursk.

Sorry Jon Boy, no peace talks!

Hahaha. Hohoho.


6,171 posted on 09/10/2024 3:35:21 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6170 | View Replies]

To: SpeedyInTexas

6,172 posted on 09/10/2024 3:37:09 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 6171 | View Replies]

To: marcusmaximus

Kyiv Independent:

“Ukraine launched a massive drone attack on several Russia’s regions overnight on Sept. 10, including Bryansk, Moscow, Tula, Kaluga, Belgorod, Kursk, Oryol, Voronezh, as well as the Krasnodar Krai region.

Russia’s Defense Ministry claimed that 144 Ukrainian drones were downed overnight, potentially ranking it among the largest strikes throughout the war. The highest number of drones – 72 – was reportedly downed over Bryansk Oblast, followed by Moscow Oblast (20) and Kursk Oblast (14)…

… Moscow Mayor Sergei Sobyanin also claimed that over a dozen drones had been shot down over Moscow Oblast en route to the capital…

…Over 30 international and domestic flights, initially scheduled for departure between 12:00 a.m. and 7:00 a.m. local time, were delayed at Vnukovo Airport because of the attack. Moscow Oblast’s Domodedovo airport was shut down in the early hours of Sept. 10.”


6,173 posted on 09/10/2024 11:11:54 PM PDT by BeauBo
[ Post Reply | Private Reply | To 6123 | View Replies]

Russian Offensive Campaign Assessment, September 10, 2024

Russia and the People's Republic of China (PRC) continue to pursue various avenues of military-technical cooperation. US Deputy Secretary of State Kurt Campbell told POLITICO on September 10 that the PRC is giving Russia's defense industry “very substantial” support in exchange for secretive Russian military technologies.[6] Campbell emphasized that the PRC is not just supplying dual-use products to Russia but is instead engaged in a “substantial effort....to help sustain, build, and diversify elements of the Russian war machine.” Campbell warned that Russia is sending the PRC safeguarded submarine, aeronautical design, and missile technologies in return, which Russia has previously been reluctant to share with Beijing. PRC officials continue to deny their support for the Russian war effort and claim that the PRC remains “impartial” when it comes to Russia's war in Ukraine, despite frequent Western reporting of the PRC's material support for Russian defense industrial output and geospatial intelligence capabilities.[7] Reports of more direct PRC support to Russia come against the backdrop of the Russia-led “Okean-2024” international naval exercises, which are currently taking place in the Pacific and Arctic oceans and Mediterranean, Caspian, and Baltic seas with the involvement of three ships, one vessel, and 15 aircraft of the PRC's People's Liberation Army (PLA).[8] Russian President Vladimir Putin announced the start of Okean-2024 on September 10 and accused the US of placing pressure on Russia and the PRC, necessitating the conduct of joint naval exercises.[9] PLA and Russian forces are also currently conducting the “Northern/Interaction-2024” joint “strategic collaboration” exercise, comprised of air force and naval drills in the Sea of Japan and Sea of Okhotsk, and a joint maritime patrol in the Pacific.[10]

The German-based Kiel Institute for the World Economy published a report on September 9 warning that Russia has significantly increased its defense industrial base (DIB) capabilities since 2022 and that depleting weapons and equipment stockpiles may not significantly impact future Russian DIB production.[74] The Kiel Institute reported that between the final quarter of 2022 and the second quarter of 2024, Russia increased tank production by 215 percent from 123 to 387 per quarter; armored vehicle production by 141 percent from 585 to 1,409 per quarter; artillery gun production by 149 percent from 45 to 112 per quarter; short-range air defense systems by 200 percent from nine to 38 per quarter; medium- and long-range air defense systems by 100 percent from six to 12 per quarter; and Lancet loitering munitions by 475 percent from 93 to 535 per quarter. The Kiel Institute caveated these statistics with the fact that 80 percent of Russian armored vehicle and tank production thus far has been a result of retrofitting existing tank hulls from pre-existing stockpiles rather than producing new vehicles, but warned that Russian armored vehicle production may not significantly decrease when Russia's existing stockpiles run out. The Kiel Institute assessed that Russia's armored vehicle production rate will likely decrease beginning in 2026 as Russia burns through its Soviet-era stockpiles but that Russia will likely open new production lines in the coming years to prepare to mitigate that effect. The Kiel Institute estimated that Russia will likely produce 350 modern tanks per year after 2026 even if Russia does not open additional production lines. The Kiel Institute also warned that Russia is working to increase domestic production of “rear systems” such as artillery and air defense and reduce its reliance on pre-existing stockpiles of such systems. The Kiel Institute also credited North Korean ammunition provisions with giving Russia a “strong oversupply” of artillery ammunition and reported that Russian forces are firing 10,000 shells per day.

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-10-2024

6,174 posted on 09/11/2024 1:34:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6126 | View Replies]

To: SpeedyInTexas

It was deliberate. Reagan knew what he was doing. He killed the tuna industry in the US - every one fled, taking their rigs and their jobs to more friendly countries, like Fiji.


6,175 posted on 09/11/2024 3:14:25 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6169 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Chase Russians on a Stolen Russian Tank! ]


Today [ Sept 11 ], there are a lot of interesting developments in the Pokrovsk direction.

Here, Ukrainians brought the Russian offensive to a grinding halt while an intense battle broke out over the railway bridge in front of Selydove. To increase the pressure on the Russian lines even more, Ukrainians unleashed a new flamethrower drone to burn the Russians out of their trenches.

The main goal of the Russian Pokrovsk offensive was to break through Ukrainian defense lines and march on the cities of Pokrovsk and Myrnohrad.

Pokrovsk is an important Ukrainian logistical center with a direct supply line to Ukrainian units fighting in Chasiv-Yar, Toretsk, and Niu-York. To launch an attack on Pokrovsk and secure their southern flank, Russians must fully break through two important Ukrainian defensive lines in a series of major towns south of Pokrovsk.

As you remember, Ukrainians suffered from a large disparity in forces compared to the Russians, and a disorganized command and control structure left them with no coordinated defensive effort. Recently, the Ukrainian high command visited the Pokrovsk direction in person to reorganize the defense and stabilize the situation.

Simultaneously, Russian forces were sustaining high losses during their offensive efforts and quickly started running out of reserves to throw at the Ukrainian lines. Russian military bloggers state that Russian units in the Pokrovsk direction have become increasingly understaffed and that Russian soldiers are becoming increasingly exhausted, but are forced to continue to attack Ukrainian lines anyway.

It is likely through the Ukrainian high command taking direct control over the situation, and the increasing Russian losses and exhaustion, that Russians have not made any significant territorial advancements in over a week. Interestingly, Russians stated that their rapid rate of advancement had stopped because Ukrainians had moved reinforcements in from the Kursk direction.

Russians noted the presence of several mechanized brigades that had been redeployed. However, these brigades had been fighting in this direction since the fall of Avdiivka, meaning Russians were likely trying to deflect from the reality of the situation.

With rapid gains out of the question, Russians have resorted back to positional warfare, launching direct frontal assaults on the Ukrainian fortress towns. Ukrainians, in turn, are managing an active defense, counterattacking vulnerable Russian advancements and positions.

Ukrainians also deployed a new type of drone here. They shared footage of an FPV- or heavy octocopter drone being mounted with a canister filled with thermite that burns at around 2,500 degrees Celsius.

Ukrainians used these drones to fly directly over Russian tree lines, detonating Russian ammunition from the intense heat and removing burnable objects that can be used as cover, such as trees, bushes, and netting.

Ukrainians also launched a series of physical counterattacks, pushing Russians out of Krasnyi Yar and undermining their attempted envelopment of Hrodivka. Geolocated footage also shows how Ukrainians launched an assault on Halytsynivka, deploying an assault group here that prevented Russians from directly assaulting Ukrainians in the Nevelske salient from behind.

Finally, an intense battle broke out over the railway bridge in front of Selydove. Geolocated footage shows how Russians moved in an armored personnel carrier to deploy an infantry assault group at the dachas in front of the Ukrainian town.

A Ukrainian tank swiftly destroyed both the armored vehicle and the Russian assault group, before moving up to fire on Russian positions on the other side of the railway embankment. Later, Russians tried again but met the same fate, as Ukrainian tanks continued to destroy any Russian attempt to advance further into the dachas.

Eventually, Russians gave up and decided to block the railway bridge so Ukrainian tanks would stop harassing their positions.

Russians even tried to park a tank directly under the bridge, but the tank crew was chased off and finished by Ukrainian FPV drones before they could disable it. Ukrainians then sent in a tank crew of their own, who quickly jumped into the vehicle and drove off with it, later releasing a video, elaborately showing off their newly gained prize.

Later, Ukrainians used an armored recovery vehicle to open up a path through the railway bridge, while Russians used a precision-guided air-to-ground missile to destroy it two days later. Nevertheless, Ukrainians reportedly re-established a presence in the southern part of Mykhailivka. Maintaining a presence here allows Ukrainians to create an advanced line of defense that would heavily disrupt another direct Russian attack on Selydove.

Overall, with the Ukrainian lines largely stabilized, and a severe lack of reinforcements making continued assaults impossible, Russians are forced to scale back their attacks and enter a period of reorganization. Russians are moving all available manpower and ammunition to this direction to restart their offensive as soon as possible.

However, the decreased Russian offensive pressure also allows Ukrainians to do the same: reinforce their units, prepare defensive positions, and set up a stronger defense. This more static type of warfare also allows the new Ukrainian ‘dragon’ drones to be much more effective, as Russians are sitting in the same trenches and tree lines for a prolonged period of time.

As these ‘dragon’ drones have been seen from the southern front up to the north, it is likely that Ukrainians have effectively created a new, widely adopted weapon designed to target Russians directly in their trenches much more effectively.


6,176 posted on 09/11/2024 3:31:44 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6169 | View Replies]


6,177 posted on 09/11/2024 3:55:54 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6097 | View Replies]


6,178 posted on 09/11/2024 4:01:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6128 | View Replies]

To: AdmSmith

Kremlin snuff box, 09/10/54
https://t.me/s/kremlin_secrets

Our insight about NATO missile attacks on Russia, unfortunately, is confirmed

We literally wrote the day before, and I quote: “ There is some bad news. NATO is very close to allowing the Kiev regime to hit any Russian territory with its weapons.” Unfortunately, this insider is confirmed; Biden will personally discuss the issue of Ukraine’s long-range strikes against us with the British Prime Minister.

“I don’t want to scare anyone, but the threat is significant. And this is serious. The enemy causes us great damage even with his drones. For example, as a result of a drone attack on the night of September 10, 11 military personnel were killed in the Bryansk and Moscow regions. Everyone knows about the consequences of enemy attacks on airfields. It will be more difficult with missiles,” said our source in the Ministry of Defense.

We should contact Andrei Belousov. We can respond to this threat by strengthening air defense. After all, even if not all enemy drones are shot down in the Moscow region, what can we say about other regions? We understand everything, but we need to stop distributing air defense systems, even to important allies from Iran. And think about protecting Russia. We hope this time we will be heard.

By the way, there is good news. There were rumors that we lost more than ten ballistic missiles as a result of the drone attack on Tuesday night. All military sources denied this information.


6,179 posted on 09/11/2024 4:57:42 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6127 | View Replies]

To: AdmSmith

Kremlin snuff box, 09/11/24
https://t.me/s/kremlin_secrets

What is happening in the Kursk region and who is to blame for the death of almost 40 military personnel during our counter-offensive?

As for our counter-offensive in the Kursk region. At the request of a number of acquaintances in the Ministry of Defense, we adhered to the regime of silence for quite a long time, but we must say a few things.

Firstly, counter-offensive actions are underway. There have been a number of serious successes and a number of liberated settlements. Many have already written about this, let’s not repeat it. Good luck to our guys who are beating the invaders!

Secondly, it is very bad that many military correspondents reported these successes yesterday. And they showed a lot of unnecessary things.

“We organized an excellent counterattack. The enemy even fell into panic in some places. But then the Armed Forces of Ukraine honored our military officers and watched the video. And they delivered several very painful blows in response. I will say this: if some individuals on the Internet had kept silent, at least 37 military personnel would be alive. And we would not have lost more than 5 units of equipment. Stop helping the enemy!” - our source at the Ministry of Defense said very emotionally.

Thirdly, the ministry categorically refuses to give forecasts about when we will liberate the Kursk region. They ask you to wait. And tell the enemy less about our successes.

We hope that the things described in this post will not happen again. And our sources among the military are hopeful.


Military Informant, 09/11/24

An extremely successful counterattack was reported in the Kursk region, which made it possible to recapture the villages of Gordeevka, Vnezapnoye, Viktorovka and Byakhovo, as well as partially the villages of Apanasovka and Snagost in the Korenevsky district.

The settlements are located in the northwestern part of the zone of control of the Ukrainian Armed Forces, and earlier it was there that the enemy tried to break through on the road to Glushkovo in order to finally force the Russian Armed Forces to leave the Glushkovo region, but was stopped.

So far there has been no objective evidence from the field.


6,180 posted on 09/11/2024 5:00:25 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6127 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,141-6,1606,161-6,1806,181-6,200 ... 20,961-20,974 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson