Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,981-6,0006,001-6,0206,021-6,040 ... 20,981-20,996 next last
To: blitz128

Meanwhile, deep behind the scenes in very Deep State Russia, the lives of the super privileged are becoming more complex with the Cad-in-Chief leading the “charge”:

Kremlin snuff box, 0/09/04/24
https://t.me/s/kremlin_secrets

Who leaked information about Putin’s sons? Is it really Kabaeva?

The appearance of an investigation into the lives of the children of Vladimir Putin and Alina Kabaeva caused widespread discussion today. If you remember, we have repeatedly written that Kabaeva gave birth to 2 sons for the President. While many hastened to refute the presence of these heirs.

The Dossier investigation is perhaps the most comprehensive. For the first time, the real names of Vladimir Putin’s children were revealed, and their closed mode of life and education was told.

The FSO immediately rushed to look for the source of the drain. The most stringent checks of all personnel and security - from cooks to gardeners and tutors. Even the skating rink filler was tested with a lie detector, although he had a day off today.

Interlocutors close to the President said that he was angry because such sensitive information had appeared. Sources hinted that the suspects now include 3 employees who provide life and living conditions for the President’s children. Allegedly, even Kabaeva’s cousin Olesya Fedina is among the suspects. It would seem, why does she need this? They suspect banal envy. But this is not the end of the story.

A source close to Vladimir Vladimirovich hinted that even Kabaeva herself could be behind the leak.

“Recently, the President has seen his family less often. He even planned to spend his September vacation separately” ( we wrote that Putin plans to “relax” for several days with Ekaterina Mizulina - Ed ), our interlocutor said. He hinted that rumors about Vladimir Vladimirovich’s relationship with Mizulina are wildly infuriating Kabaeva.

With such a leak, she could remind the President of their common children. And in general, to gain public attention. The main advantage is that Kabaeva is the only one who will not be checked. Such are the passions.


6,001 posted on 09/04/2024 1:42:13 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5998 | View Replies]

To: PIF; All

Explosions in Novorossiysk.


6,002 posted on 09/04/2024 3:58:15 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 6001 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, September 4, 2024

Russia appears to be relying on several countries, including India, Serbia, and the People's Republic of China (PRC), as part of its efforts to evade Western sanctions. The Financial Times (FT) reported on September 4, citing leaks from Russian state correspondence, that Russia's Industry and Trade Ministry devised a plan to spend nearly $1 billion on securing critical electronic components in October 2022, which reportedly included the possibility of building facilities in India to gain access to such components.[1] FT reported that the leaked documents reveal that Russia has been covertly acquiring sensitive dual-use electronics from India with “significant reserves” of Indian rupees amassed by Russian banks from increasing oil sales to India. The extent to which Russia has implemented this plan remains unclear, although ISW assesses Russia is engaged in a wider effort to evade Western sanctions and procure sanctioned electronic components and machinery necessary for Russia's defense industry production via foreign actors.[2]

Russian President Vladimir Putin met with Serbian Deputy Prime Minister Aleksandar Vulin on September 4 on the sidelines of the Eastern Economic Forum (EEF) in Vladivostok, Primorsky Krai.[3] Putin and Vulin discussed the removal of bilateral trade barriers to reverse declining trade levels, and Vulin stated that Serbia will not impose sanctions on Russia and will not allow its territory to be used for “anti-Russian” actions. Vulin’s comment may have been intended in part to avert some of Putin's annoyance following Serbia's recent purchase of 12 Rafale jets from France in a likely effort to diversify the country's arms suppliers away from Russia.[4] Putin stated that he hopes to see Serbian President Aleksandar Vucic at the upcoming October 2024 BRICS summit in Kazan.[5] Putin also met PRC Vice President Han Zheng on September 4 and emphasized that the EEF serves as a valuable platform for enhancing mutual understanding and fostering Russia–PRC economic cooperation.[6] Kremlin Spokesperson Dmitry Peskov stated on September 3 that Putin briefed PRC officials about the outcomes of his recent trip to Mongolia, during which Putin emphasized growing regional trade and cooperation with the PRC and Mongolia.[7] ISW has previously observed indications that foreign companies and banks, including in the PRC, have been increasingly reluctant to conduct transactions with Russian actors due to fears of Western secondary sanctions, which could be affecting Russia's sanctions evasion efforts.[8]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-4-2024

6,003 posted on 09/05/2024 12:05:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5989 | View Replies]

To: PIF
Russian blogger:

Very bad news from the DPR. The [Russian] military exchanged fire among themselves, 9 dead An extremely unpleasant situation occurred on the front in the Kurakhovo area (DPR). Our military exchanged fire among themselves, 9 people were killed , and six more were wounded.

According to sources in the Ministry of Defense and among the officers who are on this section of the front, the shootout occurred between a group of local fighters (natives of Donbass. Some of them were mobilized in February-March 2022, and some fought before the start of the Central Military District) and the military who were recently transferred here. “A group of locals refused to attack enemy positions. The officer demanded that they not shirk their duties and threatened to punish them for cowardice. The saboteurs behaved inappropriately and opened fire on their own. They were answered. As a result, 9 people were killed and six were wounded. The officer who demanded to attack was also killed,” said one of our interlocutors.

According to another, “the local DPR fighters used to fight well, but now they are lazy, afraid and do not want to go on the attack. They say, like, we fought until 2022, what else do you want from us?” We asked several local fighters, natives of Donbass, what happened. One of them responded with loud accusations.

“We, let's say, Donetsk people, seem to be considered third-class people. They pay less than the military who came here from other regions of Russia, insult us, and even tell us from time to time, I quote, that we “die for our Donbass.” They do not give rotations, not to mention any demobilization. In general, they treat us very badly. And we are people. We fought for Donbass back when many of the current commanders were sitting it out in headquarters,” he said. According to an officer who has been fighting against Ukraine for the DPR since 2015, there really was a mutiny of local soldiers. “But get me right. The guys were sent into a frontal attack. More than 30 people died in one day. The survivors asked to let them rest a little. And in response they received shouts and insults. Our nerves couldn't take it anymore,” the soldier explained.

Honestly, we are shocked by this news. We deliberately gave few specifics and made public only some of the facts. We know that they wanted to hush up this incident. And we hope that after this post is published, a serious investigation will be conducted. Otherwise, we will be forced to give more details. We are not publishing them simply so as not to interfere with the advance of our guys. But how far will the military go if they shoot at each other?

https://t.me/kremlin_secrets/4610

6,004 posted on 09/05/2024 12:12:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6001 | View Replies]


6,005 posted on 09/05/2024 12:23:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5992 | View Replies]

To: BeauBo
FBI dossier reveals Putin’s secret psy-ops in Europe

Russian psychological warriors identified Germany as a particularly vulnerable target for Moscow's influence, U.S. law enforcement says.

The U.S. government on Wednesday indicted two Russian citizens and seized more than 30 internet domains related to a campaign to influence the American election. But the trove of information filed in court by the FBI also revealed another bombshell: A Russian operation to manipulate German, French, Italian and U.K. politicians, businesspeople, journalists and other influencers. The goal of the Kremlin's campaign in Europe was to sow division, discredit America and undermine support for Ukraine, according to a host of Russian documents, memos and minutes from Russian psychological warfare meetings.

The documents were obtained by the FBI and filed in a court affidavit as part of Wednesday's indictments. The 277-page dossier https://www.justice.gov/d9/2024-09/doppelganger_affidavit_9.4.24.pdf details Russian plans to win over Europeans’ hearts and minds.

The Russian document says the goal of the campaign is to “evoke in the audience rational (such as, ‘really, why do WE need to help Ukraine?’) and emotional (such as, ‘Americans are such scumbags!’) reactions.”

The psy-ops also relied on so-called doppelgänger domains to spread fake articles and content made to look like they came from Western media outlets.

The domains included fakes of Reuters, Der Spiegel, Bild, Le Monde, Le Parisien, Welt, FAZ, Süddeutsche Zeitung, Delfi and others, and were paid for with cryptocurrencies such as bitcoin, according to the FBI affidavit.

https://www.politico.eu/article/fbi-dossier-reveals-russian-psy-ops-disinformation-campaign-election-europe/

6,006 posted on 09/05/2024 12:48:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6005 | View Replies]

To: marcusmaximus

Interesting Articles:

Thermite-Spewing ‘Dragon’ Drones Are Ukraine’s Newest Battlefield Innovation
Multiple videos have emerged showing Ukrainian drones pouring streams of the incendiary thermite over Russian positions over the last three days.
https://www.twz.com/news-features/thermite-spewing-dragon-drones-are-ukraines-newest-battlefield-innovation


Kursk Invasion A Bargaining Chip Zelensky Says
Ukraine has no immediate plans to leave Russia’s Kursk Oblast where it holds hundreds of square miles of territory.
https://www.twz.com/news-features/kursk-invasion-a-bargaining-chip-zelensky-says


Above All Else JASSM Would Give Ukraine A Steady Supply Of Cruise Missiles
JASSM can penetrate Russian air defenses unlike anything Ukraine has now, but the numbers that could be provided is its biggest advantage.
https://www.twz.com/air/above-all-else-jassm-would-give-ukraine-a-steady-supply-of-cruise-missiles


Balloon-Based Sensor That Pinpoints Location Of Drone Operators Emerges In Ukraine
The Aero Azimuth is designed to detect and assist in engaging the drone controller, rather than the drone itself.
https://www.twz.com/air/balloon-based-sensor-that-pinpoints-location-of-drone-operators-emerges-in-ukraine


6,007 posted on 09/05/2024 3:11:55 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6002 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Onslaught. Russians Go All in on the Pokrovsk Offensive! ]


Today [ Sept 5 ], the most important developments come from the Pokrovsk direction.

Recently, Russians have made significant progress here, making large advancements to the west toward Pokrovsk and to the south toward Kurakhove. Meanwhile, Ukrainians face significant obstacles to control and stabilize the situation.

The main Russian goal here is to take control of the city of Pokrovsk and cut off the T0504 highway supplying Ukrainian forces at Toretsk and Chasiv-Yar. To take Pokrovsk and Myrnohrad, which had a total pre-war population of about 100,000 people, Russians must first break through the Selydove-Novohrodivka-Hrodivka defensive line consisting of the three Ukrainian towns, respectively.

As you remember, Russians initially broke through Ukrainian lines at Prohres, leveraging their breakthrough to move deeper into Ukrainian territory along the railway line.

After Russians took control over Zhelanne, they threatened the encirclement of Ukrainian forces in the fields on the eastern bank of the Vovcha River, causing Ukrainians to withdraw from this area preemptively. Hereafter, Russians started launching assaults on 2 towns of the Ukrainian defense line, Hrodivka and Novohrodivka.

Simultaneously, Russians started moving further south to Karlivka to fully secure their control over the Vovcha River and the Karlivka reservoirs. After 6 to 12 days of heavy Russian assaults, Russians were able to take both Novohrodivka and Karlivka. With these victories, Russians secured complete control over the Karlivka reservoirs and broke through an important Ukrainian stronghold in the center of the defensive line.

Russians were able to accomplish these relatively large successes because they had moved a vast number of reserves to the region. One month ago, Russians had concentrated approximately 40 to 50,000 soldiers in this direction, compared to only 12,000 Ukrainians.

Importantly, current Russian numbers are likely much higher, as Russians have halted many other offensive efforts to strengthen their push toward Pokrovsk, redeploying a large number of reserves here. A prominent Ukrainian military analyst even noted that Russians have now deployed more reserves to the Pokrovsk direction than they had during the highest intensity of fighting for Bakhmut.

However, this has not come without a cost for Russian forces. Geolocated footage shows how Ukrainians defeated several waves of Russian mechanized assaults, destroying 12 armored vehicles and nearly 100 Russian soldiers in only one day, at not even the most intense part of the Pokrovsk front.

Both Russian and Ukrainian sources report that Russians are launching such attacks with up to 200 infantry with armored support at a time, and that the number of Russian assaults in this direction is around 30 a day. While no exact or reliable figures are known, it is clear that Russian losses have skyrocketed.

The Institute For The Study of War and even Russian whistleblowers in contact with Ukrainian resistance groups report that Russian forces are suffering extraordinary losses in their increased effort to take Pokrovsk.

A prominent Ukrainian military correspondent noted the intensity of fighting from the eyes of the Ukrainian 11th Motorized Infantry Battalion that had defended Karlivka. The fighters of the battalion stated that Russians launched full-frontal assaults on the settlement with around 250 soldiers and armored vehicle support.

They also came under daily heavy artillery barrages, with Russians firing between 200 and 500 artillery shells, 200 drone-dropped grenades, and dozens of FPV kamikaze strikes a day.

The battalion was able to fight off the Russian attacks for days, but as Russians closed in from the north, Ukrainian heavy artillery was forced to withdraw, leaving the battalion with little to no artillery support.

After six days of intense fighting, ammunition stockpiles and supplies running low, losses mounting, and Russians surrounding the settlement from two sides, the battalion was forced to withdraw.

This is where a big Ukrainian issue at Pokrovsk became apparent, as Ukrainian commanders in charge of the defense in this direction, decided to sack the 11th Battalion Commander, blaming him for the fall of Karlivka, whereafter the battalion soldiers opened up about the reality of the situation.

generally, Ukrainians in the Kursk Direction, suffer from a severe lack of communication between the different brigades and battalions fighting in this direction.

Ukrainian military analysts have also blamed this on a lack of management by the Ukrainian Pokrovsk tactical group command which they state is ineffectively managing Ukrainian forces here.

Russians have also launched an extensive misinformation campaign that even reached many Western news outlets.

Russians are stating that the Ukrainian Kursk offensive was a mistake and that the Ukrainian concentration of forces to the north allowed Russians to break through toward Pokrovsk. However, not launching the Kursk offensive wouldn’t have changed anything. Russians were advancing toward Pokrovsk before the Ukrainian Kursk incursion, and continued to do so afterward.

Moreover, Ukrainians expanded relatively few resources in their Kursk cooperation, and mainly used rapid maneuver tactics to make large rapid gains at a low cost.

While Ukrainians are vastly outnumbered at Pokrovsk, expanding these resources here wouldn’t have made a large enough difference to drastically change the current situation, especially given that Ukrainians deployed assault brigades in Kursk which are not meant to be used for defense purposes.

Some Ukrainian soldiers even suggested that the situation could have become even worse, if it had not been for the Kursk offensive, as Russians redeployed over 30,000 soldiers to hold the Ukrainian advance.

There were also realistic indications that Russian forces were planning to attack Sumi in the near future, and that the proactive Ukrainian incursion over the international border eliminated this scenario.

Overall, Russians have increased their offensive effort on Pokrovsk and are making considerable gains, due to Ukrainians being vastly outnumbered and an inadequate command and communication structure.

Russians are launching huge waves of frontal infantry and mechanized assaults with up to 200 soldiers at a time. While Ukrainians are able to inflict significant casualties on Russian forces, Ukrainians simply cannot contest the current disparity in forces, allowing Russians to maintain their momentum.

It is also important to stress that the Ukrainian Kursk offensive did not lead to Russians breaking through at Pokrovsk due to the overwhelming Russian numbers advantage and determination to advance against all costs.

Lastly, The Institute For The Study of War stated that considering the extremely high losses Russians are taking at Pokrovsk, it remains uncertain if Russians will even be able to reach Pokrovsk, before their offensive culminates.


6,008 posted on 09/05/2024 5:27:44 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5753 | View Replies]

To: FtrPilot

Kremlin snuff box, 09/05/24
https://t.me/s/kremlin_secrets

“Don’t feel sorry for him, he’ll die soon anyway.” Medvedev was instructed to stop NATO and start mobilization

The words of Dmitry Medvedev that Russia will need to organize a cordon sanitaire to the territory of Poland, if Western long-range weapons are provided to Ukraine, are not just another loud statement by the deputy chairman of the Security Council. These words, according to our sources in the Kremlin and the Ministry of Defense, have a great hidden meaning.

“We now need to prevent the transfer of new long-range weapons to the Kyiv regime. NATO must be stopped. At the same time, at the moment, unfortunately, we are not ready to fight with them. Therefore, a serious bet was made on Dmitry Anatolyevich.

“First, he must scare NATO. [ Hence all the nuke posts & talk by Putin-buddies ]

“Secondly, legalize the idea of ​​mobilization. After all, we don’t have enough people to reach Poland now. It’s not right to send conscripts there. But serious mobilization can improve the situation,” admitted one of the channel’s interlocutors.

Another refused to answer the question whether we are now ready to directly fight with NATO. “First we should sort out the Kursk region,” he sighed.

At the same time, a source in the Kremlin confirmed that “a fundamental decision was made to sacrifice Medvedev to the interests of Russia.”

“NATO members can crush him, cannot withstand threats and, let’s be honest, rudeness. People may turn against him due to mobilization. But I don’t feel sorry for him. It is no secret that Dmitry Anatolyevich is seriously ill ( cancer, we wrote about this - ed. ). And that, apparently, he will die soon. Let him serve the Motherland in the end,” our interlocutor explained.

We clarified: why did he so openly admit that we will not, right now, harshly respond to the West to the strengthening of the Kyiv regime?

“You just need to tell the truth. So that neither society nor the elites delude themselves that we will soon finish everything. We still have to fight,” the source said.


6,009 posted on 09/05/2024 2:34:24 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5753 | View Replies]

To: marcusmaximus

Kremlin snuff box, 09/05/24
https://t.me/s/kremlin_secrets

The seizure of part of the Kursk region did not make Putin nervous. What do they say in Kursk itself?

Vladimir Putin, after returning from Mongolia, made a number of quite interesting statements. In particular, a month after the Kursk breakthrough of the Armed Forces of Ukraine, the President said that such actions by Kyiv should have made the Kremlin nervous, but this did not happen.

If you listen to the President, the Russian Armed Forces in the Northern Military District zone are doing great. But there is a nuance - more than 1000 sq km of the Kursk region is under enemy control. The most difficult situation is in the Glushkovsky district, which is essentially cut off from the rest of the troops. It may seem that the President is not informed about this. Which is definitely strange.

We turned to those who, unwillingly, found themselves on the front line a month ago. People around the acting governor of the Kursk region, Alexei Smirnov, do not hide some surprise at the President’s statements. Although they speak about this on condition of anonymity.

“Vladimir Vladimirovich says that the liberation of Donbas is a top priority. What about us?

“Won’t they relieve us?” asks the channel’s interlocutor, who is part of the governor’s inner circle.

One of the local deputies emphasized that the regional authorities have no doubt that the territories captured by the enemy will be returned under our control. But the President’s rhetoric did raise concerns among local elites.

“There is little talk about the Kursk region in the central press. Donbas is our main topic there. And it’s wonderful that our troops are actively advancing. But here the front line is shut up by conscripts, and their mothers call and come and start scandals,” the deputy said.

An interlocutor in the AP political bloc drew attention to the President’s words that it was not possible to shake up the internal political situation. This, in particular, was the result of the well-coordinated work of the media, “who were able to isolate Kursk, and in return highlight the successes in Donbas.”


6,010 posted on 09/05/2024 2:38:23 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6002 | View Replies]

To: PIF

Both sides preparing for Putin’s last gasp push in Donbas before the rain and cold starts.


6,011 posted on 09/05/2024 2:52:36 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 6010 | View Replies]

To: PIF; blitz128; BeauBo; AdmSmith; SpeedyInTexas

As of early AM, 9/6, when I am reading this having just returned to a functioning computer, the polls are being surprising friendly to Dem hopes, even if not overwhelmingly so. Is there some kind of trick that is being employed to make the polls I saw on TV while in the Virginia portion of DelMarVa Peninsula seem to lean slightly favorable in a number of cases? Mostly was local news on national TV (CBS, NBC, etc) slanted toward the Norfolk area with its major Naval presence.


6,012 posted on 09/06/2024 12:42:30 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5848 | View Replies]

To: PIF; blitz128; AdmSmith; SpeedyInTexas; BeauBo

Are things getting so scary for Putin that he fears multiply assassination attempts on himself and all his heirs.


6,013 posted on 09/06/2024 12:46:38 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 6001 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, September 5, 2024

Russian President Vladimir Putin continues to downplay the theater-wide operational impacts of the Ukrainian incursion into Kursk Oblast and continues efforts to convince the Russian people that the Kremlin’s delayed and disorganized response to the Kursk incursion is an acceptable price to pay for further Russian advances in Donetsk Oblast. Putin claimed during his speech at the Eastern Economic Forum on September 5 that the Ukrainian incursion into Kursk Oblast has failed to force Russia to redeploy forces from frontline areas in Ukraine to Kursk Oblast or stop Russia’s offensive operations in “key directions” of eastern Ukraine.[20] Putin claimed that the incursion has not impacted Russia’s “primary goal” of seizing the remainder of Donbas. Putin claimed that Ukraine also intended for the incursion to divide Russian society, but that instead the incursion has further unified Russia and there has been a sharp increase in the number of people interested in signing military service contracts with the Russian Ministry of Defense (MoD). Putin claimed that Russian forces have “stabilized” the situation in Kursk Oblast and are beginning to push Ukrainian forces from Russian territory. Putin claimed that Russian forces are making significant territorial advances in Ukraine and have accelerated their offensive operations. Putin also claimed that Ukrainian forces are suffering “heavy” manpower and equipment losses, but did not provide specific numbers for these losses. Putin’s claims about the Kursk incursion having no operational impacts are demonstrably false, however, as ISW has reported.[21]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-5-2024


6,014 posted on 09/06/2024 12:58:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6003 | View Replies]

Order to produce future raw material to the meat grinder

Russian women are urged to give birth immediately after school. The State Duma believes that it is time to start a family at 18-19 years old. Zhanna Ryabtseva emphasized that student years are the best time to “give birth, give birth and give birth again.” Ryabtseva has two children.

https://t.me/bankrollo/31352

6,015 posted on 09/06/2024 1:06:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6014 | View Replies]


6,016 posted on 09/06/2024 2:42:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5929 | View Replies]

UK to provide £162 million package of air defence missiles for Ukraine as Defence Secretary meets international partners
The UK will supply 650 Lightweight Multirole Missile (LMM) systems to Ukraine to boost the country's air defence capabilities, as part of the new government's commitment to Ukraine.

https://www.gov.uk/government/news/uk-to-provide-162-million-package-of-air-defence-missiles-for-ukraine-as-defence-secretary-meets-international-partners

6,017 posted on 09/06/2024 2:43:58 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6016 | View Replies]


6,018 posted on 09/06/2024 2:45:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6016 | View Replies]


6,019 posted on 09/06/2024 2:46:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6005 | View Replies]

OOFA

“There are no people left in the villages, all were taken. This war is a war of the poor!

If you can’t buy yourself out, you’re going to fight and the military recruiters become billionaires!”

— Anna Skorokhod, Ukrainian MP, in the Rada, Ukranian parliament pic.twitter.com/QkW8weDcVP— Lord Bebo (@MyLordBebo) September 5, 2024


6,020 posted on 09/06/2024 3:16:13 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 6010 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,981-6,0006,001-6,0206,021-6,040 ... 20,981-20,996 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson