Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: agitprop; attackoneurope; bidenswar; bobomaximus; cheesymaximus; dailydeathfap; dailypropaganda; deathcult; dualcitizenssuck; escalation; fishiemaximus; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; hopium; liberalatpost7819; nato; oyveygoyim; pancakemaximus; phdft; propagandareturns; put; putin; russia; siloviki; snufffilmsonfr; snufffilmtx; snuffyfromtexas; spammyintexas; speedomaximus; stankazztexicunt; stenrynning; talkingtomypif; ukraine; unhealthyobsession; warporn; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,961-5,9805,981-6,0006,001-6,020 ... 8,141-8,143 next last
To: JonPreston

🚨 Major reshuffle of the government is ongoing, with 5 ministers handing their resignations to the Chairman of the Verkhovna Rada.

According to the leader of SN's parliamentary faction Davyd Arakhamiia, "more than 50% of the government will be changed". pic.twitter.com/JCSkP1u9hv— Ukraine Elects (@ukraine_elects) September 3, 2024


5,981 posted on 09/03/2024 3:37:05 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5980 | View Replies]

To: JonPreston

Zelenskys Dictatorship is in chaos.

Olga Stefanishyna, the Deputy Prime Minister of Ukraine responsible for Kiev's "integration into NATO and the European Union",

has submitted a resignation letter, pic.twitter.com/xAquXEhdoh— Chay Bowes (@BowesChay) September 3, 2024


5,982 posted on 09/03/2024 3:48:45 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5981 | View Replies]

To: FtrPilot

Moscow oil refinery suspends unit’s operations following large-scale Ukrainian drone attack, Reuters reports.

Moscow.

Kyiv Independent recounts:

“Gazprom Neft’s Moscow Oil Refinery suspended operations at the plant’s Euro+ refining unit following a fire caused by a purported large-scale Ukrainian drone attack on the region on Sept. 1, Reuters reported, citing its sources...

A drone was reportedly destroyed near the Moscow Oil Refinery, according to Moscow Mayor Sobyanin. One of the refinery’s buildings was damaged in a fire following the attack, according to Russia’s state-owned Ria Novosti outlet. (apparently caused by debris, in the same size and shape as drones)

...the Euro+ unit accounts for about 50 per cent of the plant’s refining capacity.”


5,983 posted on 09/03/2024 4:25:43 PM PDT by BeauBo
[ Post Reply | Private Reply | To 5982 | View Replies]

To: PIF

I got ya curious how good that service is for “average “ citizens, imagine oligarchs have the same service /s


5,984 posted on 09/03/2024 4:48:25 PM PDT by blitz128
[ Post Reply | Private Reply | To 5978 | View Replies]

To: BeauBo

Falling debris 😎


5,985 posted on 09/03/2024 4:49:12 PM PDT by blitz128
[ Post Reply | Private Reply | To 5983 | View Replies]

To: BeauBo

The usual is back with his same projection lol


5,986 posted on 09/03/2024 4:50:20 PM PDT by blitz128
[ Post Reply | Private Reply | To 5983 | View Replies]

🚨BOOM: 700 Western mercenaries have just been killed and wounded at a NATO communications training centre in Poltava as a result of a direct hit by Russian Iskander-M missile.

⚡️This is Russia's greatest single strike against Western mercenaries of the war so far. pic.twitter.com/ZoRW6Jdvt0— Aussie Cossack (@aussiecossack) September 3, 2024


5,987 posted on 09/03/2024 5:56:52 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5982 | View Replies]

To: SpeedyInTexas

The big Picture: A great replacement of Russian gas for the long term.

North America LNG Exports to Double

OilPrice.com reports:

“The capacity for North American LNG exports is set to double within the next three years to 24.4 billion cubic feet per day (Bcf/d) from 2023 levels, the EIA said on Tuesday.

The forecast assumes that all LNG projects that are currently under construction begin operating as planned in Mexico, the United States, and Canada.

The EIA expects the bulk of the export expansion will be in the United States at 9.7 Bcf/d, with Mexico and Canada accounting for the remaining 3.3 Bcf/d. This is based on the 10 new projects currently under construction in North America—5 of which are in the United States, including Plaquemines Phases I and II, Corpus Christi Stage III, Golden Pass, Rio Grande Phase I, and Port Arthur Phase I.”

Meanwhile (OilPrice.com separately reports):

The U.S. Tightens The Screw Again On Russia’s Vital LNG Sector

“The US Treasury and State departments ramped up the pressure on Russia’s critical LNG sector again last week.

One of the principal reasons for the focus of the U.S. and its allies on effectively destroying Russia’s ship-borne LNG sector is that it now acts as a key source of revenue for the Kremlin.

Another major concern for the U.S. and its key allies is that it does not want Russia to regain the level of political and economic influence that it had over the 27 countries that constitute the European Union.”


5,988 posted on 09/03/2024 8:10:38 PM PDT by BeauBo
[ Post Reply | Private Reply | To 5983 | View Replies]

Russian Offensive Campaign Assessment, September 3, 2024

Russian President Vladimir Putin concluded his trip to Mongolia by signing agreements that strengthen bilateral economic ties and trilateral energy relations between Russia, Mongolia and the People’s Republic of China (PRC).[27] Putin and Mongolian President Ukhnaagiin Khurelsukh emphasized increasing projects under the Mongolia-Russia-China Economic Corridor program, which supports the Russian “Greater Eurasian partnership” economic initiative, China’s “One Belt, One Road” initiative, and Mongolia’s “Steppe Road” development plan.[28] Putin emphasized that the Soyuz Vostok gas pipeline connecting Russia, Mongolia, and the PRC is fully constructed and awaits state examination.[29] Putin invited Kurelsukh to the BRICS forum in Fall 2024 and suggested that Mongolia join the BRICS Plus/Outreach format.[30] Mongolia is also reportedly close to completing a temporary trade agreement with the Russian-led Eurasian Economic Union (EAEU).[31] Russia and Mongolia also signed bilateral agreements to increase oil and petroleum product exports from Russia to Mongolia, and Putin announced that Russian energy company Inter RAO will assist in restoring Ulaanbaatar Thermal Power Plant No. 3 (TPP-3).[32]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-3-2024


5,989 posted on 09/03/2024 10:05:27 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5954 | View Replies]

Chinese carmaker Chery for the first time took the first place in the Forbes rating of the largest foreign companies in Russia for 2023 with the company’s revenue reaching 590.3 bln rubles ($6.78 bln).

Japanese tobacco manufacturer JT Group with the revenue of 480 bln rubles ($5.5 bln) came in second and the top three leaders were rounded off by US tobacco company Philip Morris International with a total revenue of 440.2 bln rubles ($5.05 bln). The top ten companies also include PepsiCo, Great Wall Motor, Auchan Retail/Elo, Raiffeisen Bank International, Metro, Nestle, and Geely Automobile.

https://tass.com/economy/1837715

Check companies here https://leave-russia.org/


5,990 posted on 09/03/2024 10:20:05 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5989 | View Replies]

To: PIF
Russian blogger

Suvorov’s ashes will most likely be buried. But first they will “give another chance” to correct the situation on the front in Kursk Oblast.

After our publication about the great commander's ashes being “cruelly” dumped in one of the warehouses, a group of military men addressed Andrei Belousov. The minister was asked to “correct this shameful situation,” a source in the Ministry of Defense said. “Andrei Removich made a balanced decision. Of course, you can't do this with the ashes of Alexander Vasilyevich. Although Andrei Removich no longer wants to pray next to them. Therefore, I think Alexander Vasilyevich will be buried soon,” our source noted.

At the same time, Suvorov’s remains will receive, according to another source among the military, “another chance to help the Motherland.” The commander's ashes will soon be put in order as much as possible and taken to Kursk Oblast. There, in particular, near the front line, group prayers and meetings of officers will be held near the remains of the commander. It is also possible that the ashes will be on board the aircraft that strikes the Ukrainian Armed Forces.

In addition, an option is being considered in which Suvorov’s ashes will be placed on one of our strategic bombers - so that missile strikes on the energy sector and military infrastructure of Ukraine are as effective as possible. But this will happen only on the condition that “everything works out in the Kursk region.” The sources refused to provide other details. They fear that in the Kursk region the enemy will “set up a hunt” for the remains of the great commander.

https://t.me/kremlin_secrets/4605

Is this how to respect the remains of a dead person? Traveling around and losing parts?

5,991 posted on 09/03/2024 10:32:04 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5894 | View Replies]

1 390 !!!


5,992 posted on 09/03/2024 11:48:36 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5956 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Command in Panic! Pay africans to Defend Kursk! ]


Today [ Sept 4 ], there are a lot of updates from the Kursk direction.

Here, for the past 3 weeks, the Ukrainian forces have progressed with their incursion into the Russian Federation by continuing their offensive actions in the Kursk region.

According to the Ukrainian Commander-in-Chief Oleksandr Syrsky, up until now the confirmed Russian territory liberated by the Ukrainians amounts to almost 1,300 sq, km, and analysts evaluate that Ukrainians have the potential to seize an additional 700 sq, km in the Glushkovo area. For comparison, during the 6-month-long Kherson counteroffensive in 2022, Ukrainians liberated 4,800 sq, km

The fact that the Ukrainians have successfully and so rapidly taken and kept holding such a large piece of territory inside Russia and are continuing to advance even further has led to different reactions within the Russian society and military.

Firstly, at least a dozen clips show how the Russian civil population left behind in the territory now under Ukrainian control live now and how much they depend on the Ukrainian soldiers.

Residents in Sudzha complained that they have not been evacuated by the Russian military and are even being exposed to their strikes as seen in this geolocated footage from the local ice hockey stadium showing the devastation caused by a Russian air bomb.

Recent footage highlights Ukrainian soldiers delivering humanitarian aid to Russian civilians, and how a local woman warmly greets the Ukrainian soldiers, offering blessings and expressing gratitude for their assistance. Another clip shows the women, notably trying to speak Ukrainian almost fluently, as they interact with the soldiers.

In a particularly interesting scene, a Ukrainian soldier is seen helping a disabled woman drink water, with the woman lamenting that her family has abandoned her. The humane treatment demonstrated by the Ukrainian army has even led one woman to declare on camera that “Sudzha is Ukraine.”

This series of interactions vividly illustrates the significant difference in how Ukrainian and Russian soldiers conduct themselves when entering foreign territory, with the Ukrainians fostering goodwill and support among the local population.

Simultaneously, Russian soldiers released several frustrated videos addressing the male population of the Kursk region, criticizing them for fleeing the war, rather than staying to defend their homeland. They urged the men to either take up arms or, at the very least, dig trenches and provide their vehicles to support the soldiers risking their lives in defense of Kursk.

However, the local population remains skeptical of these military appeals and prefers to evacuate the danger zone as quickly as possible - a sentiment deepened by the actions of Russian forces themselves. The situation was further inflamed by Chechen Akhmat Spetsnaz Commander Apty Alaudinov, who harshly called for conscripts to join combat operations, using derogatory terms to describe those who refused.

This irony is not lost on the public, especially given the behavior of the Chechen forces. Recently, shocking surveillance footage has emerged showing Russian soldiers looting shops in Russian villages under their control. One video captures Chechen soldiers robbing an electronics store, while another shows regular Russian troops looting a supermarket in Glushkovo.

The poor discipline among those supposedly defending the local population has led to widespread complaints, with some reports even alleging assaults against young girls in the region.

The unsettling reports emerging from the Kursk region have sparked considerable turmoil within Russian society. A recent poll conducted by the state-owned Public Opinion Foundation at the end of August revealed that 28% of respondents expressed outrage or dissatisfaction with the actions of Russian authorities over the past month.

This growing discontent has been accompanied by a significant 3.5% decline in President Putin’s approval rating. This drop is particularly notable given that the Ukrainian forces have only captured a relatively small portion of the Kursk region, yet the impact on public sentiment has been substantial.

The pressure on Russian military leadership to stabilize the situation in the Kursk region has led to drastic measures with significant losses and ongoing battles, across multiple front lines in Ukraine.

Russia’s depleted pool of available troops has forced them to deploy African mercenaries to defend their territory. Videos from both Ukrainian and Russian sources confirm the presence of such troops on the front lines, some of whom have been captured as prisoners of war.

Simultaneously, footage from the Kursk region shows a tank with the old Belarusian flag highlighting the irony of Russia relying on foreign soldiers, while Russian and Belarusian Russian volunteers fight for Ukraine against Putin’s regime.

This underscores the increasingly fragmented and desperate state of Russian military efforts in the area.

Overall, the Ukrainian advances in the Kursk region represent a significant psychological blow to Russia, highlighting the deteriorating state of Russian military discipline and the erosion of civilian morale.

The contrasting behavior between Ukrainian and Russian forces, where Ukrainian soldiers have gained local support, while Russian troops are mired in misconduct, underscores the widening gap in the legitimacy and effectiveness of each side.

The deployment of African mercenaries by Russia due to personnel shortages signals a critical strain on Russian resources, and further weakens the internal cohesion of their forces.

These developments not only expose vulnerabilities within Russia’s military operations, but also suggest a growing internal discontent that could undermine the Kremlin’s control and complicate its efforts to sustain the war effort.


5,993 posted on 09/04/2024 4:19:53 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5992 | View Replies]

To: PIF
53% of industrial enterprises reported the absence of domestic suppliers capable of replacing unavailable imported equipment, materials and components. This remains one of the main problems of Russian industry, according to a survey by the Institute of Economic Forecasting (IEF) of the Russian Academy of Sciences. At the same time, the situation has improved over 2.5 years - then 62% of enterprises reported the absence of domestic suppliers.

https://t.me/banksta/57349

Maybe some of the ones that existed 2.5 years ago don't exist today?

5,994 posted on 09/04/2024 5:37:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5993 | View Replies]

To: AdmSmith

Maybe some of the ones that existed 2.5 years ago don’t exist today?

or they are fudging the numbers again.


5,995 posted on 09/04/2024 7:10:45 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5994 | View Replies]


5,996 posted on 09/04/2024 7:56:47 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5987 | View Replies]

To: PIF

The usual is digging deep, apparently Russian changes in govt and military are superb and show how successful the smo has been, Kursk is memory holed and apparently so is western front


5,997 posted on 09/04/2024 10:50:55 AM PDT by blitz128
[ Post Reply | Private Reply | To 5995 | View Replies]

To: PIF

They can’t compete with Chinese, but as to numbers I doubt even Putin knows what is going on. Bet he has been told Steiner is on his way to save the day too


5,998 posted on 09/04/2024 10:54:41 AM PDT by blitz128
[ Post Reply | Private Reply | To 5995 | View Replies]

To: JonPreston

5,999 posted on 09/04/2024 11:43:20 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5996 | View Replies]

Zelensky Losing All Of Donetsk?

Kyiv Troops Flee Blindly, Leave Behind Weapons Amid Russian Gains

Click on the image for music and additional information!

6,000 posted on 09/04/2024 1:07:37 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5999 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,961-5,9805,981-6,0006,001-6,020 ... 8,141-8,143 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson