Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

1 390 !!!


5,992 posted on 09/03/2024 11:48:36 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5956 | View Replies ]


To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Command in Panic! Pay africans to Defend Kursk! ]


Today [ Sept 4 ], there are a lot of updates from the Kursk direction.

Here, for the past 3 weeks, the Ukrainian forces have progressed with their incursion into the Russian Federation by continuing their offensive actions in the Kursk region.

According to the Ukrainian Commander-in-Chief Oleksandr Syrsky, up until now the confirmed Russian territory liberated by the Ukrainians amounts to almost 1,300 sq, km, and analysts evaluate that Ukrainians have the potential to seize an additional 700 sq, km in the Glushkovo area. For comparison, during the 6-month-long Kherson counteroffensive in 2022, Ukrainians liberated 4,800 sq, km

The fact that the Ukrainians have successfully and so rapidly taken and kept holding such a large piece of territory inside Russia and are continuing to advance even further has led to different reactions within the Russian society and military.

Firstly, at least a dozen clips show how the Russian civil population left behind in the territory now under Ukrainian control live now and how much they depend on the Ukrainian soldiers.

Residents in Sudzha complained that they have not been evacuated by the Russian military and are even being exposed to their strikes as seen in this geolocated footage from the local ice hockey stadium showing the devastation caused by a Russian air bomb.

Recent footage highlights Ukrainian soldiers delivering humanitarian aid to Russian civilians, and how a local woman warmly greets the Ukrainian soldiers, offering blessings and expressing gratitude for their assistance. Another clip shows the women, notably trying to speak Ukrainian almost fluently, as they interact with the soldiers.

In a particularly interesting scene, a Ukrainian soldier is seen helping a disabled woman drink water, with the woman lamenting that her family has abandoned her. The humane treatment demonstrated by the Ukrainian army has even led one woman to declare on camera that “Sudzha is Ukraine.”

This series of interactions vividly illustrates the significant difference in how Ukrainian and Russian soldiers conduct themselves when entering foreign territory, with the Ukrainians fostering goodwill and support among the local population.

Simultaneously, Russian soldiers released several frustrated videos addressing the male population of the Kursk region, criticizing them for fleeing the war, rather than staying to defend their homeland. They urged the men to either take up arms or, at the very least, dig trenches and provide their vehicles to support the soldiers risking their lives in defense of Kursk.

However, the local population remains skeptical of these military appeals and prefers to evacuate the danger zone as quickly as possible - a sentiment deepened by the actions of Russian forces themselves. The situation was further inflamed by Chechen Akhmat Spetsnaz Commander Apty Alaudinov, who harshly called for conscripts to join combat operations, using derogatory terms to describe those who refused.

This irony is not lost on the public, especially given the behavior of the Chechen forces. Recently, shocking surveillance footage has emerged showing Russian soldiers looting shops in Russian villages under their control. One video captures Chechen soldiers robbing an electronics store, while another shows regular Russian troops looting a supermarket in Glushkovo.

The poor discipline among those supposedly defending the local population has led to widespread complaints, with some reports even alleging assaults against young girls in the region.

The unsettling reports emerging from the Kursk region have sparked considerable turmoil within Russian society. A recent poll conducted by the state-owned Public Opinion Foundation at the end of August revealed that 28% of respondents expressed outrage or dissatisfaction with the actions of Russian authorities over the past month.

This growing discontent has been accompanied by a significant 3.5% decline in President Putin’s approval rating. This drop is particularly notable given that the Ukrainian forces have only captured a relatively small portion of the Kursk region, yet the impact on public sentiment has been substantial.

The pressure on Russian military leadership to stabilize the situation in the Kursk region has led to drastic measures with significant losses and ongoing battles, across multiple front lines in Ukraine.

Russia’s depleted pool of available troops has forced them to deploy African mercenaries to defend their territory. Videos from both Ukrainian and Russian sources confirm the presence of such troops on the front lines, some of whom have been captured as prisoners of war.

Simultaneously, footage from the Kursk region shows a tank with the old Belarusian flag highlighting the irony of Russia relying on foreign soldiers, while Russian and Belarusian Russian volunteers fight for Ukraine against Putin’s regime.

This underscores the increasingly fragmented and desperate state of Russian military efforts in the area.

Overall, the Ukrainian advances in the Kursk region represent a significant psychological blow to Russia, highlighting the deteriorating state of Russian military discipline and the erosion of civilian morale.

The contrasting behavior between Ukrainian and Russian forces, where Ukrainian soldiers have gained local support, while Russian troops are mired in misconduct, underscores the widening gap in the legitimacy and effectiveness of each side.

The deployment of African mercenaries by Russia due to personnel shortages signals a critical strain on Russian resources, and further weakens the internal cohesion of their forces.

These developments not only expose vulnerabilities within Russia’s military operations, but also suggest a growing internal discontent that could undermine the Kremlin’s control and complicate its efforts to sustain the war effort.


5,993 posted on 09/04/2024 4:19:53 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5992 | View Replies ]


6,005 posted on 09/05/2024 12:23:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5992 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson