Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,541-5,5605,561-5,5805,581-5,600 ... 22,221-22,232 next last
To: AdmSmith
Russian Offensive Campaign Assessment, August 20, 2024

The Russian military command continues to complicate and bureaucratize its thus-far ineffective command and control (C2) structure for the Russian response to the Ukrainian incursion into Kursk Oblast. Russian Defense Minister Andrei Belousov announced on August 20 that he appointed Russian Deputy Defense Minister Colonel General Yunus-Bek Yevkurov as Deputy Head of the “Coordinating Council” within the Russian Ministry of Defense (MoD) for military and security issues in Bryansk, Kursk, and Belgorod oblasts and stated that Yevkurov is already currently in Kursk Oblast.[18] Belousov’s decision to appoint Yevkurov — who heads the Russian MoD’s Africa Corps and has been the face of Russian military outreach and cooperation with African countries since the dissolution of the Wagner Group in 2023 — may suggest that the Russian MoD removed Yevkurov from his position in Africa Corps, as a Kremlin-affiliated milblogger previously speculated, and that that the Russian MoD is temporarily deprioritizing defense cooperation efforts in Africa in response to the incursion into Kursk Oblast.[19]

Belousov also tasked five members of the Coordinating Council with addressing specific issues related to the Ukrainian incursion into Kursk Oblast. Belousov announced that Deputy Defense Minister Lieutenant General Andrei Bulyga is responsible for resolving logistics, transport, and assisting civilian authorities in civilian evacuations; that Deputy Defense Minister Alexei Krivoruchko is responsible for solving problems related to military-technical support; that Deputy Defense Minister Pavel Fradkov is responsible for engineering and construction; and that the Russian MoD’s Main Military Medical Directorate Head Dmitry Trishkin is responsible for medical support.[20] Belousov also announced the creation of the Bryansk, Kursk, and Belgorod groupings of forces and stated that their unspecified commanders and an unspecified representative of the Russian General Staff are responsible for protecting civilians from drone strikes and other attacks.[21] The Russian MoD additionally created a special task force at the National Defense Control Center to monitor issues in Bryansk, Kursk, and Belgorod oblasts.[22] The National Defense Control Center's Deputy Head Lieutenant General Yuri Korsachev claimed that the center's task force has already resolved 25 issues voiced by the Bryansk, Kursk, and Belgorod operational headquarters, of which most requested additional drone supplies, mobile electronic warfare (EW) systems, radios, radio jammers, and all-terrain vehicles.[23]

Belousov did not comment on how the Coordination Council officials, the National Defense Control Center's task force, and the newly-created groupings of forces will interact with the existing C2 structure that the Kremlin established when it tasked that Russian Federal Security Service (FSB) with conducting a counterterrorism operation in Bryansk, Kursk, and Belgorod oblasts. The increasing bureaucratization of the Coordination Council and other Russian MoD structures dedicated to defending against the incursion into Kursk Oblast will likely create additional confusion within the Russian MoD and friction among the Russian MoD, FSB, and Rosgvardia, all of which are attempting to operate in Kursk Oblast. ISW continues to assess that complex and overlapping responsibilities and the seemingly ever-growing list of actors the Kremlin has tasked with responding to the Ukrainian incursion impede Russia's ability to establish effective joint C2 structures.[24]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-august-20-2024

5,561 posted on 08/21/2024 1:25:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5531 | View Replies]

To: PIF

Russian blogger:

The enemy attacked Moscow at night. Everything is as we warned

Last night, enemy drones flew to Moscow . Thanks to the fact that the capital is tightly protected by air defense, the drone raid was repelled. Our sources are convinced that there will be more such attacks in the coming days.

Note that earlier, intelligence reported to the president about the preparation of August provocations in Moscow and shelling of the capital. We wrote about this in more detail here .

Why are the Armed Forces of Ukraine attacking Moscow, knowing that there are serious air defense forces around our capital? The answer is simple - in this way they force us to keep these forces around Moscow. And this means that a number of other objects (both on the front and beyond) may be left without protection. A recent example of this is the oil depot in Proletarsk, Rostov Region, where a fire has been extinguished for the fourth day .

Interlocutors in the mayor’s office noted that the recent activation of the protective shutter control system at the Arbatskaya metro station was not accidental. At the same time, sources refuse to say whether this was the result of testing or whether the failure was caused by external factors.

Until the end of August, it is worth being more careful and, at the very least, remembering again how far the nearest bomb shelter is from your home.

https://t.me/kremlin_secrets/4546


5,562 posted on 08/21/2024 1:28:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5552 | View Replies]

To: AdmSmith

5,563 posted on 08/21/2024 1:30:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5533 | View Replies]

To: PIF
🔥🔥🔥

🇺🇦 Ukrainian Forces strikes on 🇷🇺 Russian pontoon crossings with GMLRS and ATACMS in Kursk region.

Also destroyed Russian engineering equipment

https://x.com/GloOouD/status/1826171488895992240

The video at the link is posted all over x.com

I would not want to be a ruzzian engineer.


5,564 posted on 08/21/2024 4:19:19 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5555 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ A Huge Russian Camp Wiped Out in 1 Blow With HIMARS ]


Today [ Aug 21 ], there are a lot of new developments in the Kursk direction.

Here, Ukrainians have conducted a large-scale drone strike on Russian military airfields, severely impacting Russia’s aerial capabilities. Moreover, Ukrainians immediately leveraged this success to initiate the first attacks in their westward offensive, pushing their forces closer to a decisive breakthrough.

Firstly, Ukrainian officials stated that Russian forces had increased the number of glide bomb strikes on the Sumy region in Ukraine to approximately 40 to 50 strikes per day. Russians targeted various Ukrainian infrastructure in an attempt to undermine Ukrainian logistics and troop movements.

Unfortunately for Russians, Ukrainians retaliated. The Ukrainian General Staff reported that they conducted a large-scale drone strike against Russian airfields in Kursk, Voronezh, Borisoglebsk, and Savasleyka.

The combined operation of the Ukrainian security service, military intelligence, and armed forces targeted Russian airbases that were actively used to conduct glide bomb strikes. The Ukrainian general staff reported that the strikes targeted aircraft, repair facilities, fuel storage, and warehouses with ammunition, which likely indicates Russian glide bombs.

Satellite footage of the Borisoglebsk airfield shows Ukrainians destroyed and damaged several hangars where aircraft were being repaired and maintained, along with one damaged and one destroyed Russian SU-35 fighter plane stationed out in the open.

While no satellite footage of the other Ukrainian strikes has yet become available, local residents around the Savasleyka airfield reported hearing over 10 distinct explosions. Additional geolocated footage indicates that Ukrainians destroyed a Mig-31 supersonic interceptor here, able to carry air-launched Kinzhal ballistic missiles, widely used to bomb Ukrainian cities.

This was not the only recent Ukrainian strike, as a post by a Russian journalist indicates that Ukrainians hit a Russian training base with HIMARS, as he complains that Russian forces still use training bases within Ukrainian striking distance.

Additionally, Russian soldiers continue to be forced to gather in the open yard in the morning to wait to be addressed by their commander, making these Russian military bases an even more attractive target for Ukrainians. Russian sources published a video allegedly showing that they managed to track down and destroy a Ukrainian HIMARS system.

However, Ukrainians have been using decoy inflatable mockups of high-value military equipment for years. A Ukrainian soldier shared a photo of such an inflatable HIMARS mockup, seemingly at the exact location of the Russian strike, meaning Russians likely hit a decoy again.

As you know from a previous report, Ukrainians had identified a weak spot in the Russian lines to the west and were preparing to strike. What makes this area even more challenging to hold for Russians, is that it is entirely surrounded by Ukrainian forces from three sides and separated from the rest of Russian territory by a river.

Notably, there are only three bridges over this river that Russians can use to resupply their forces here, at Karyzh, Zvannoye, and Glushkovo. Ukrainians understood this and, over the last two days, launched a series of strikes on these bridges, destroying them in the process.

The Ukrainian Air Force released footage of 2 of these strikes, showing them finishing off the Glushkovo bridge after HIMARS had previously damaged it and destroying the Zvannoye bridge with a similar bomb. While no footage has yet been released of the destruction of the Karyzh Bridge, Russian sources reported that the bridge was under fire by Ukrainian rockets and artillery.

With all the bridges over the Seym River destroyed, Russian forces are now completely cut off from friendly reinforcements and logistics.

While satellite footage shows that Russians have set up a pontoon bridge, even Russian military analysts note that this is pointless, as the new pontoon bridge remains well within Ukrainian artillery range, and expect it to be destroyed soon.

With the bridges destroyed and Russians effectively cut off from their logistics, Ukrainians launched a reconnaissance-in-force operation on the settlement of Tetkino to test Russian defenses and willingness to fight.

Ukrainians quickly captured the western bank of the Seym River in its entirety, as well as numerous positions in the town itself. On the western bank, Russians quickly retreated back to the settlement and blew up 2 minor crossing points as soon as Ukrainians launched their attacks.

While this temporarily secured the Russian northern flank against Ukrainian assaults, the Russian southern flank remains completely open. This was also most definitely not the main Ukrainian offensive in this direction, as there were no heavy clashes, and Ukrainians seemingly only took up preliminary positions in the town to test the Russians’ strength.

Additionally, the fact that Russians immediately retreated and gave up on their positions on the western bank indicates that Russians are not in a position to put up significant resistance, and are likely to either surrender or be quickly destroyed by a more significant Ukrainian attack.

Lastly, at the Russian 2024 Army exhibition, Russian developers presented a new electronic warfare system meant for helicopters. This comes shortly after Ukrainians destroyed two Russian attack helicopters with FPV drones during the Kursk offensive. The new Volnorez-X anti-drone aviation system is supposed to protect Russian helicopters against Ukrainian drones by creating a 100-meter disruption zone around the aircraft.

Interestingly, Ukrainians recently captured an intact Volnorez electronic warfare system meant for armored vehicles, in the Kursk region. Ukrainians state that the manual captured alongside the system did not note any technical specifics about the system. However, as it was captured fully intact, it may be dissected and used for research purposes to find possible weaknesses that may be used to circumnavigate the effect of the disruption zone.

Overall, these last few days were characterized by supporting actions in preparation for a larger offensive to the west of the current breakthrough. Ukrainians launched the largest strike on Russian military aviation, since the beginning of the war, to undermine Russian air operations that could endanger their coming offensive.

Similarly, Ukrainians fully cut off Russian logistics to more than 30 settlements under the river. With the initial intensity of Russian resistance in Tetkino being small, Ukrainians will likely soon launch a second offensive and add over 600 square kilometers of Russian territory to their current gains.


5,565 posted on 08/21/2024 4:42:47 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5564 | View Replies]

To: SpeedyInTexas

Interesting Articles:

Thousands Of Russian Troops In Kursk Likely Trapped By Blown Bridges
Ukraine is trying to close in on Russian troops south of the Seim River to clear out another pocket of Russia’s Kursk Oblast.
https://www.twz.com/news-features/thousands-of-russian-troops-in-kursk-likely-trapped-by-blown-bridges


Ukraine Pushing Westward In Kursk To Create A “Buffer Zone”
After dropping multiple bridges, Ukraine’s push westward, south of the Seim River, would give it more Russian territory along its border.
https://www.twz.com/news-features/ukraine-pushing-westward-in-kursk-to-create-a-buffer-zone


Palmdale UFO Scare Leads To Revelations About Mystery Drone Incursions Over Secretive Plant 42
While it isn’t clear if the two are related, our investigation into the sightings has revealed that the home to Skunk Works has experienced a very concerning rash of drone incursions.
https://www.twz.com/air/palmdale-ufo-scare-leads-to-revelations-about-mystery-drone-incursions-over-secretive-plant-42


Laser Weapon Appears On Chinese Amphibious Assault Ship
A Chinese Type 071 amphibious transport dock has emerged from a refit sporting a new laser directed energy weapon system.
https://www.twz.com/air/laser-weapon-appears-on-chinese-amphibious-assault-ship


5,566 posted on 08/21/2024 4:46:55 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5465 | View Replies]

To: AdmSmith

Kremlin snuff box, 08/21/24
https://t.me/s/kremlin_secrets

Upon the enemy’s advance in the Zaporozhye region. There is alarming news, but the information needs to be verified. Don’t rush to conclusions and don’t fall for the hype. Don’t panic.

As soon as there is more reliable data, we will inform you.

Kremlin snuff box
Telegram
Romanov Light]
https://t.me/romanov_92/45062

20.08.2024
Pologovsky district, Zaporozhye region, Russia.

Having waited for the transfer of our forces to the Kursk direction, the Ukrainian Armed Forces began an offensive in the sector ...

/Gerasimov, are you sleeping?


5,567 posted on 08/21/2024 4:50:16 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5563 | View Replies]

To: AdmSmith

Kremlin snuff box, 08/21/24
https://t.me/s/kremlin_secrets

Putin reprimanded Kadyrov because of Alaudinov. And he said to look for another “successor”

Vladimir Putin visited Grozny the day before, where he met with Ramzan Kadyrov. We found out what Putin talked about with Kadyrov.

Firstly, quite recently Ramzan Akhmatovich underwent a new course of treatment and received a new opinion from doctors.

The Chechen leader’s condition has improved, but overall the prognosis is disappointing - he has no more than 12-14 months to live.

Secondly, the situation in the Northern Military District zone and in the Kursk region was discussed. The President is dissatisfied with the latest statements by Apti Alaudinov. Before arriving in the Caucasus, Vladimir Vladimirovich was informed that Alaudinov’s words had heated up the situation in the army. In particular, between Akhmat and other units.

The President expressed doubts that “a person who cannot keep his mouth shut in time will be able to manage something big.” Apparently, in this way Putin made it clear that Alaudinov’s prospects for leading Chechnya after Kadyrov are zero. However, one of the interlocutors believes that they were talking about the position of Minister of Defense.

Even we have doubts here, because Belousov was only recently appointed, and there are much more influential, experienced and authoritative candidates for this position, if they are needed.

Thirdly, Vladimir Putin discussed with Kadyrov the possibility of more active participation of Akhmat in combat operations at the front. Kadyrov promised to increase the number of fighters on the front line, in particular in the Kursk region. Kadyrov was tight-lipped about his “successor.” The consequences of intensive treatment were taking their toll.


5,568 posted on 08/21/2024 4:52:51 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5563 | View Replies]

To: PIF
The oil depot in Proletarsk continues to burn...

The fourth day has already passed.

Not a word about in ru media.

https://x.com/EuromaidanPR/status/1826167857245294828


5,569 posted on 08/21/2024 5:05:32 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5568 | View Replies]

To: SpeedyInTexas
What the heck?

Today Zelenskyy has banned the Church in Ukraine.

Dozens of priests will be thrown to prisons! They got into people’s souls!

The God was kicked out of Ukraine

Keep telling about it! Tell the world that Zelenskyy is doing evil! pic.twitter.com/7ea5uyc9RD— Diana Panchenko 🇺🇦 (@Panchenko_X) August 20, 2024


5,570 posted on 08/21/2024 5:24:55 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5465 | View Replies]

To: PIF
⚡️🇺🇦 Ukrainian soldiers from the 225th Separate Assault Battalion destroy 🇷🇺 Russian infantry and a warehouse of ammunition in a house in the Kursk region

https://x.com/front_ukrainian/status/1826146019932836258


5,571 posted on 08/21/2024 5:34:43 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5569 | View Replies]

To: AdmSmith

“Russian MoD is temporarily deprioritizing defense cooperation efforts in Africa in response to the incursion into Kursk Oblast.”

There’s an effect. France’s revenge


5,572 posted on 08/21/2024 6:21:53 AM PDT by BeauBo (J)
[ Post Reply | Private Reply | To 5561 | View Replies]

To: FtrPilot; blitz128; BeauBo; SpeedyInTexas; AdmSmith; PIF; marcusmaximus; Monterrosa-24; ...

The good news for Ukraine supporters just keeps coming. I will view your link about the fuel fires after writing this comment.

I just spent 40 minutes viewing the link below (total run time 1 hour 14 minutes). Forty minutes because Constantine, the narrator moved to answering comments from viewers at this point. His English was good, so no written info. He said his program was called “Patron” but I don’t know the actual spelling. The topic was estimates of the cost to the people of Kursk and Russia caused by the Ukraine invasion and occupation of Kursk. He also included estimates for costs in Bolgorod.

He estimates the total Russian loss of population caused by this “war” is around 3,000,000 people, mostly the educated and professional population. He described his experiences fleeing to Tashkent, where 40,000 Russians in a city of 5 million resulted in desperate searches for a roof to live under and major inflation. He estimates the total exodus from Kursk and Bolgorod to be about 1/4 million (Kursk with 1 million population). This will cause substantial problems in Russia for inflation of food and real estate. Costs to buy housing beyond the war zone are around $40,000 while people desperate to sell homes in Kursk are getting $15,000.

He points out both Oblasts have the famous rich, black soil which makes for major harvests of wheat, sunflowers, and corn. There are also large numbers of pigs, and cows (milk). There will be no harvests, and what happens to the animals? Significant food inflation to be expected in Russia, on top of the housing cost increases. He also mentions iron, and nuclear power as other economic loses or threatened loses. The loss in harvests he estimates as around 1 million metric tons, and since I was not taking notes, I don’t remember his estimated costs. I hope I have correctly remembered the other figures I quoted, but enjoy the link if you relish details. Constantine describes his search for specific information on his estimates of quantities, costs and loses to the people and businesses.

This video is the best effort I have seen to quantify the cost to Russia of this Ukrainian conquest. Even if Ukraine were to hurry back home rather soon, the overall cost would be great, but far greater if they stay a while. He points out that perhaps the greatest loss to Putin and Co. will be the information that 1/4 million unhappy refugees will be able to spread throughout the Russian countryside. No longer will the smooth, optimistic lies that “all is well in Russia” be the only source of information for the Russian people. Now I return to the link below to see what comments the listeners have over the remaining 34 minutes.

https://www.youtube.com/watch?v=q0aZ_kp6AKw


5,573 posted on 08/21/2024 6:27:05 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5569 | View Replies]

To: gleeaikin; SpeedyInTexas; AdmSmith; marcusmaximus

I went back to the video to check on the audience comments and answers portion. I did not find this as satisfying as the first part as there were comments to regular commenters and not necessarily questions to answer, and of course as a new viewer, the names had no meaning for me. On rereading comment #5573 I see I need to correct spelling of southern neighbor BElgorod.

I listened again to the first part of the program where Constantine went into some detail about why Russia’s economy is in so much trouble. Things like labor shift to war industry, international sanctions, etc. which most of us who have followed this war closely already know about. However, for someone only recently following this war some of this may be new and interesting info. After that he goes into great detail on how the Kursk invasion will make matters that much worse for Russia. He ended with a long Christian prayer.


5,574 posted on 08/21/2024 8:14:42 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5573 | View Replies]

To: PIF

“Ukrainians launched the largest strike on Russian military aviation, since the beginning of the war”

Following shortly after what was previously the largest strike on Russian military aviation, since the beginning of the war.

The magnitude and frequency of Ukrainian drone attacks is growing, and is likely to keep growing, from here on out.

This may solve the problem with Russian glide bombs. This may decimate Russian Aviation and Air Defenses, opening the skies for Ukraine’s Aviation to achieve supremacy. This may degrade Russia’s oil and gas revenues, past the breaking point. This may significantly degrade Russia’s Defense Industrial Base.

Ukrainian drone supremacy/dominance is a new phase of the war, that we are now entering.


5,575 posted on 08/21/2024 8:46:03 AM PDT by BeauBo (J)
[ Post Reply | Private Reply | To 5565 | View Replies]

To: gleeaikin

“why Russia’s economy is in so much trouble”

The reasons that you listed are major problems for the Russian economy. Another, that is classic for wartime economies, is inflation. Russia continues to print a flood of new rubles, that is entrenching inflation there, for years to come.


5,576 posted on 08/21/2024 9:03:11 AM PDT by BeauBo (J)
[ Post Reply | Private Reply | To 5574 | View Replies]

To: FtrPilot
Despite the inevitable 101% success of Russian Air Defense (in Russian reports), the oil depot in Proletarsk continues to burn and explode.

From some website on the Internet, called EurAsia Daily (Подробнее: https://eadaily.com/en/news/2024/08/21/oil-depot-in-proletarsk-became-inflamed-on-the-fourth-day-another-tank-exploded ):

"The fourth day the fire continues at the oil depot in Proletarsk, Rostov region, which was attacked by drones of the Armed Forces of Ukraine. According to reports from the field, another tank exploded on Wednesday (August 21). The tank farm itself has been dug in, but it is not yet possible to extinguish the fire inside it"...

..."According to (the telegram channel Don Mash), more than 600 rescuers are working on the spot — they are trying to prevent the fire from spreading further.

On Sunday night and in the morning, the tank farm was attacked by drones of the Armed Forces of Ukraine. The Ministry of Defense reported that the drones were shot down. Debris fell on the tank farm. This turned out to be enough to start a fire, which is still being extinguished."

Innocent.

5,577 posted on 08/21/2024 9:54:02 AM PDT by BeauBo
[ Post Reply | Private Reply | To 5569 | View Replies]

To: FtrPilot
LA Times today (21 Aug):

"Ukraine's Air Force said Russia launched 69 drones and three missiles at Ukraine overnight, describing it as Russia's biggest drone attack so far in August. Ukraine said its air defenses shot them down and no casualties or destruction were reported."

(Meanwhile, Ukraine has launched multiple 100+ drone waves into Russia this month. Ukraine launched more drones than Russia in July, and that gap seems likely to expand widely in coming months)

"Moscow came under one of the largest attacks by Ukrainian drones since the start of fighting in 2022, Russian authorities reported Wednesday, saying they destroyed all of those headed toward the capital."

"This was one of the biggest attempts of all time to attack Moscow using drones,” Moscow Mayor Sergei Sobyanin said on his Telegram channel."

"Ukrainian drone strikes have brought the fight far from the front line into the heart of Russia, targeting the Russian capital and second city St. Petersburg, and an airport in Western Russia, according to Russian officials.

Since the beginning of this year, Ukraine has stepped up aerial assaults on Russian soil, targeting refineries and oil terminals."

5,578 posted on 08/21/2024 10:39:57 AM PDT by BeauBo
[ Post Reply | Private Reply | To 5569 | View Replies]

To: FtrPilot; blitz128; marcusmaximus

BDA from Kyiv Independent:

“Ukraine’s attack on the Savasleyka airbase in Russia’s Nizhny Novgorod Oblast on Aug. 16 destroyed three Russian planes and damaged around five others, a military intelligence source told the Kyiv Independent on Aug. 21.

Russian warplanes based at the Savasleyka airfield include MiG-31K aircraft, a carrier of Kinzhal ballistic missiles that Russia uses to attack Ukraine.

According to the source, the kamikaze drones operated by Ukraine’s military intelligence (HUR) destroyed a Russian MiG-31K/I and two Il-76 aircraft and damaged about five aircraft, possibly including one more MiG-31K/I.

The previous strike on the Savasleyka airbase, carried out by HUR on Aug. 13, hit a Russian fuel and lubricants warehouse and damaged a MiG-31K/I plane, the source told the Kyiv Independent.

Explosions were also reported at the Borisoglebsk and Baltimore airbases in Voronezh Oblast overnight on Aug. 14.”


5,579 posted on 08/21/2024 12:19:13 PM PDT by BeauBo
[ Post Reply | Private Reply | To 5569 | View Replies]

To: BeauBo

Russians come up with a novel way to put out fires ...


Kremlin snuff box, 08/214/24
https://t.me/s/kremlin_secrets

They began to extinguish a burning oil depot in the Rostov region with the help of prayers. If it works out, the successful experience will be used in the Kursk region

We wrote that in the Kursk region they are planning to hold a religious procession against the invasion of the Ukrainian army. According to the latest information, the decision whether it will take place will be made after problems in another region of our country affected by the war are resolved with the help of prayer, icons and holy relics.

Priests joined in extinguishing the fire at an oil depot attacked by the enemy in Proletarsk, Rostov region, and held a prayer service not far from the site of the fire.

“It was preparation. Very soon, particles of the relics of St. Matrona of Moscow will be brought to the site of the fire. And a serious prayer service will be held, which, we hope, will help extinguish the hellish flames brought by the enemy to Russian soil,” a source in the Volgodonsk diocese of the Russian Orthodox Church told us.

According to him, the relics of Matrona of Moscow will be brought in the strictest secrecy to protect them from attacks by drones and missiles. They are sent to the Rostov region on the personal instructions of Andrei Belousov.

Sources in the Ministry of Defense confirmed this information. They say that the success of prayers in the Rostov region will determine whether a religious procession will be held in Kursk against the invasion of the Ukrainian Armed Forces and whether the relics of the saint will be sent there, as planned.

“We believe that God will reveal himself in difficult times. At the same time, as military people, we are waiting for a concrete result,” said one of our interlocutors.

We would like to draw your attention to one important thing. We are deeply religious people. And we believe that prayers will really help us defeat the enemy and protect Russia from him. But, if, against the backdrop of the veneration of holy relics, our problems with air defense are not resolved for months and even years, the army and special services fail at the moment of the enemy’s invasion of our territory, then prayers alone cannot save us.

We hope we are not the only ones who understand this. Because sometimes the saddest thoughts come to mind ...


5,580 posted on 08/21/2024 1:12:08 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5579 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,541-5,5605,561-5,5805,581-5,600 ... 22,221-22,232 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson