Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: agitprop; bidenswar; bobomaximus; dailydeathfap; dailypropaganda; deathcult; dualcitizenssuck; escalation; fishiemaximus; ghoulishdelight; gleefulnosegold; globohomo; hopium; nato; oyveygoyim; phdft; propagandareturns; put; putin; russia; siloviki; snufffilmsonfr; snufffilmtx; snuffyfromtexas; spammyintexas; speedomaximus; stankazztexicunt; talkingtomypif; ukraine; unhealthyobsession; warporn; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,301-5,3205,321-5,3405,341-5,360 ... 6,421-6,433 next last
Pokrovsk!!

Russian advances towards Pokrovsk
Via @MilitarySummary pic.twitter.com/TlDeTB6vUH— -- GEROMAN -- time will tell - 👀 -- (@GeromanAT) August 16, 2024


5,321 posted on 08/16/2024 4:39:01 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5319 | View Replies]

To: PIF

….. unburdened by the past

Definitely makes sense now 🤬


5,322 posted on 08/16/2024 4:50:32 AM PDT by blitz128
[ Post Reply | Private Reply | To 5319 | View Replies]

To: JonPreston

WOW! Almost a kilometer!!! Meanwhile, Russia loses 1000 kilometers


5,323 posted on 08/16/2024 4:53:14 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5321 | View Replies]

To: JonPreston

The Russian Defense Ministry is transferring conscripts to the Kursk region from other regions to strengthen the defense against the Ukrainian Armed Forces, write mothers and close relatives of soldiers. Here is one of many similar messages: “My conscript was sent to the zero point of the border in Sudzha Lebedevka, they explained that he would just stand there. As a result, I don’t know where he is now, what happened to him, and the military, no matter who I call, tells me: Your son’s details are unknown. What should I think now????” More and more appeals from relatives of conscripts are coming to the committees of soldiers’ mothers.

During the offensive in the Kursk region in August 2024, the Ukrainian Armed Forces repeatedly announced the capture of dozens of Russian servicemen, including conscripts. The parents of the captured soldiers are demanding their exchange. Back in March 2022, Putin promised not to send conscripts to participate in the hostilities in Ukraine. Apparently, the case with the defense of the Kursk region will be an exception, since even formally the authorities may not call the hostilities in the region part of the so-called special military operation.
https://t.me/vchkogpu/50004


5,324 posted on 08/16/2024 5:01:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5321 | View Replies]

To: BeauBo

Bricktop_NAFO@Bricktop_NAFO
https://x.com/Bricktop_NAFO/status/1824262677390098732

Why Ukraine Will Not Take Down Kerch Bridge……….. Yet

Oleksiy Danilov, the Secretary of the National Security and Defense Council of Ukraine, has already said this publicly about the Kerch Bridge in the context of Ukraine’s strategic interests. He stated that the bridge’s presence, while significant, was actually advantageous for Ukrainian forces.

The bridge, being important to Putin, requires Russian air defenses in Crimea to protect it. This, in turn, makes it easier for Ukrainian forces to destroy these defenses when drawn out and dragged into Crimea.

This is the bigger picture.

We want clear skies for F-16’s. Taking the bridge down is one thing, but depleting all Russian air defenses so they are unable to protect the front lines, oil refineries, their airspace against F-16’s, their borders, Russian mainland and their naval fleet, now that’s priceless.


5,325 posted on 08/16/2024 5:22:44 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5315 | View Replies]

To: SpeedyInTexas

nice up tick in casualthy and tank counts.



5,326 posted on 08/16/2024 5:24:41 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5312 | View Replies]

To: PIF

“The (Kerch) bridge, being important to Putin, requires Russian air defenses in Crimea to protect it. This, in turn, makes it easier for Ukrainian forces to destroy these defenses”

Interesting point.


5,327 posted on 08/16/2024 5:48:01 AM PDT by BeauBo
[ Post Reply | Private Reply | To 5325 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Unprecedented Victory: Ukrainians Take 1,000sq km & 2,000 POWs ]


Today [ Aug 16 ], there are a lot of updates from the Kursk direction.

The Ukrainian incursion into Russian territory is advancing steadily along four distinct axes, with daily confirmations of new territorial gains by Ukrainian forces.

Two days ago, Ukrainian Commander-in-Chief Oleksandr Syrsky announced that Ukrainian forces had established control over approximately 1,000 square kilometers of Russian territory within Kursk Oblast, including up to 74 settlements. However, recent reports suggest that this controlled area has expanded significantly.

The Ukrainian incursion, meticulously planned along four distinct vectors, has been executed by some of the most elite and battle-hardened brigades in the Ukrainian army, following the military strategy of “striking with their best weapon at the enemy’s weakest point.”

In the eastern and northwestern directions, Ukrainian forces are focused on encircling the settlement of Korenevo. The 103rd Territorial Defense Brigade is advancing from the south, particularly in the Snagost area, aiming to secure a connection via the highway. Simultaneously, the 82nd Airborne Brigade is making frontal and northern advances towards Korenevo.

Additionally, coordinated sabotage and reconnaissance units are actively operating behind Korenevo’s lines. Recent Russian reports confirm Ukrainian advances in Snagost, while Ukrainian military analyst Kostyantyn Mashovets noted progress up to the settlement. Geolocated footage published three days ago supports these claims, showing Ukrainian forces operating southeast of Korenevo.

In the northern sector, Ukrainian forces, led by the 80th Airborne Brigade, are advancing toward Lgov along the Sudzha-Lgov road. The extent of their probing raids and the exact locations where they have established permanent control remain unclear. However, it seems confirmed that several small settlements in this zone still contain isolated Russian troops, who may be encircled and awaiting surrender.

It’s important to note that the Kursk nuclear power plant, one of the three largest in the Russian Federation, is situated near Lgov. While military analysts generally dismiss the idea that the plant is a direct objective for Ukrainian forces, holding positions within long-range artillery range could still pose a significant threat.

This strategic positioning could serve as a valuable leverage point in negotiations, even without the need to capture the facility itself.

In the northwestern sector, the 22nd Brigade is pushing along the R200 road from Sudzha towards the city of Kursk, with reported clashes near Martynovka. Confirmed reports indicate that Russian forces have constructed fortification lines 50 kilometers from the border, running parallel to the E38 road.

This defensive move suggests uncertainty on the Russian side regarding when or where they might be able to stabilize the situation, implying that Ukrainian-controlled territory could still expand significantly.

In the eastern sector, Ukrainian forces, led by the 92nd Mechanized Brigade, are executing a pincer movement on both sides of the Psel River, targeting the area around the Belitsa and Giri settlements.

Their primary objective is to secure control of two key bridges, which serve as the main river crossings in the region. These bridges are crucial for facilitating any larger troop movements, especially those involving mechanized forces.

In several of these Russian localities, Ukrainian forces appear to be employing the same tactic used near the border crossings: encircling settlements to force Russian troops to surrender.

The element of surprise, combined with inadequate defensive preparations and the inexperience of many Russian soldiers caught in the initial stages, has significantly contributed to these surrenders.

Moreover, the clear disconnection of these troops from Russian support in the north has further weakened their resolve. This is evident from the numerous videos that have surfaced in recent days, showing Russian forces laying down their arms.

Just a few days ago, the number of prisoners of war was estimated at around a 1,000. However, recent analyses suggest that this figure may now be approaching 2,000.

This development delivers a significant blow to the image of Russian forces and provides Ukraine with a valuable asset for future prisoner exchanges.

Ukrainian forces have also carried out strikes on a Russian military Airfield in Lipetsk Oblast. According to the Ukrainian general staff, the strikes targeted warehouses storing light bombs and other critical facilities at the Lipetsk military airfield near Lipetsk city.

Recent satellite imagery confirms that several ammunition warehouses at the airfield were destroyed in the attack.

This strike is part of a broader campaign against Russian airfields, aimed at disrupting aviation operations that could target Ukrainian troop concentrations, mechanized units, engineering equipment, and newly established fortifications in the Kursk incursion, and goes on top of the Russian helicopter losses incurred in combat in this region.

Overall, the positive momentum of this Ukrainian incursion continues to build.

Analysts are divided in their interpretations, but generally agree on two main objectives behind the operation.

Firstly, by establishing a foothold in Russian territory Ukrainian forces compel Russia to redeploy significant resources to counter the incursion, thereby weakening Russian offensives elsewhere. Some Russian analysts have warned of potential additional Ukrainian raids in the coming days, suggesting that this strategy may be aimed at diverting Russian personnel and material from ongoing operations in Northern Kharkiv Oblast and other critical frontline areas.

Secondly, on a strategic level Ukrainian officials have indicated that controlling and entrenching in a substantial portion of the Kursk region would strengthen Ukraine’s bargaining position in any future negotiations. If successful, this incursion could allow Ukraine to liberate its Southeastern territories by diplomatic means, if an exchange of territories becomes a viable option.


5,328 posted on 08/16/2024 5:58:01 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5312 | View Replies]

To: SpeedyInTexas

Another convoy meets its maker

Kremlin snuff box, 08/16/24
https://t.me/s/kremlin_secrets

The nightmare in the Kursk region repeated itself. Will we ever stop traveling in convoys???

Not far from the village Korenevo in the Kursk region a convoy of the Russian Armed Forces was attacked [ https://t.me/kremlin_secrets/4489 ]. It seemed that after the incident in the Rylsky region, conclusions would be drawn.

But no - the troops continue to move in columns. The enemy, alas, does not forgive mistakes. And we shouldn’t. The one who gave the order to move forward in a column must be demonstrably punished. Andrey Removich, you wanted truthful information? Here you go, figure it out!

The losses are now being clarified, but we are talking about serious numbers. Very serious.


5,329 posted on 08/16/2024 6:04:08 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5312 | View Replies]

To: SpeedyInTexas

Kremlin snuff box, 08/16/24
https://t.me/s/kremlin_secrets

Important clarification about conscripts

Firstly, given the need to stop the Kursk breakthrough of the Ukrainian Armed Forces as soon as possible, conscripts were not only not withdrawn from the Kursk region, but soldiers were also transferred there from other regions of Russia.

Formally, everything is within the framework of the law and the president’s promises. Vladimir Vladimirovich promised that conscripts would not take part in the SVO. And the Kursk region has not yet been recognized as a northwestern military zone ( here is a special “hello” to the Ministry of Defense ).

Secondly, several hundred conscripts were captured, died or went missing. It is difficult to establish what happened in the territory now controlled by the enemy. We can only hope that the conscripts, along with the rest of our military, will be released from captivity as part of the exchange.

We wrote earlier that, alas, they are not included in the list of those who need to be pulled out first.

In this regard, appeals from mothers and close conscripts directly to the President and Minister of Defense may have an effect. So far, as sources told us, there are no plans to stop the appearance of such requests. However, if you remember the story with the wives of the mobilized, after some time it will be more difficult to ask such uncomfortable questions.

On the other hand, many conscripts - young guys - ended up in the hands of the enemy. We must do everything to bring them home!


5,330 posted on 08/16/2024 6:05:53 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5312 | View Replies]

To: SpeedyInTexas

Kremlin snuff box, 08/16/24
https://t.me/s/kremlin_secrets

The enemy launched a missile strike on Crimea. There’s good news and bad news

On the night of Friday, August 16, ATACMS missiles struck the Crimean Bridge and Kerch.

According to our sources in the Ministry of Defense, there is good news - the enemy failed to hit the bridge; all the missiles that flew at it were shot down.

Unfortunately, there were also losses; several enemy missiles reached their targets. “They hit an important military facility. We will not reveal which one. I can only say that 2 air defense installations were lost. 11 military personnel were killed ,” one of our sources said.

What do we have to say about this? We again call on Andrei Belousov to resolve the issue with the air defense of Crimea. How long will our military continue to die at a distance from the front line?

We also ask the Minister of Defense to comment on rumors that “due to the unstable situation and current threats”, several air defense systems were recently transferred to Moscow and the Moscow region from Crimea. We don’t believe it, but such rumors are actively circulating.


5,331 posted on 08/16/2024 6:07:34 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5312 | View Replies]

To: ETCM; BeauBo
I believe a 4-ship of F-16s firing 8 JASSMs would drop at least 1 span.

The strike package should include ATACMs, Stormshadow missiles, drones, and pre-emptive HARMs, all on Crimea air defense.

5,332 posted on 08/16/2024 6:49:25 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5317 | View Replies]

To: BeauBo; SpeedyInTexas; AdmSmith; PIF; blitz128; Zhang Fei

I wonder if China will pursue the Belt and Road Initiative across the Stans into the Middle East and southern Europe? Russia certainly does look iffy at the moment. I also wonder how much of Chinese investments Russian Oligarchs managed to pocket from the Chinese? They certainly seem to have a done a good job of stealing from Russian military production contracts among other things.


5,333 posted on 08/16/2024 7:23:22 AM PDT by gleeaikin ( Question authority as you provide links;)
[ Post Reply | Private Reply | To 5282 | View Replies]

To: PIF; All
Good Morning America




5,334 posted on 08/16/2024 7:45:20 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5333 | View Replies]

To: ETCM; BeauBo; SpeedyInTexas; AdmSmith; blitz128; PIF

I suspect Ukraine does not want to destroy the auto part of the Kerch Bridge. There are probably still 1/2 million Russians in Crimea that Ukraine would prefer to have self evacuate, rather than have to worry about food and water for them. Many were opportunists with connections who probably grabbed desirable shore real estate, but a lot of elderly pensioners are reported to have moved there to enjoy milder climate in their sunset years.

When a long strip of the road bridge was bombed, an oil train was on the other bridge next to and above the level of the road bridge. It burned for many hours, and did structural weakening to the bridge so that only commuter rail cars were safe to run on the less affected of the 2 rail lines. One major freight train was run over the rail bridge some months (6?) ago, but that apparently is the only one. Probably discovered the bridge could not stand that stress safely.

They had been using the large ferries that I believe could carry 600 or more autos each. This was how they were transporting heavy military equipment into Crimea, but now all 3 big ferries have been made non operational. So the military situation for supplying heavy equipment is very bad.
Bridges on the north border to Crimea have been damaged. I read recently that a rail line was being built from Rostov on Don, but that will be close enough for Ukraine to hit it with heavy missiles.


5,335 posted on 08/16/2024 8:12:34 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5317 | View Replies]

To: PIF; All
“In Kursk, all eyes on the Glushkovo area today. Russian reports that either one or both bridges over the river Seym have been destroyed by Ukrainian HIMARS strikes, cutting off that swath of Russia from reinforcements as Ukrainian forces advance from the east. Red dots are the bridge locations. “




5,336 posted on 08/16/2024 8:29:50 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5335 | View Replies]

To: FtrPilot; All

Tu-22M3 debris

https://x.com/RALee85/status/1824463586564927737


5,337 posted on 08/16/2024 8:31:12 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5336 | View Replies]

To: PIF; All
“Russian channels say that the bridge over the Seym river near Glushkovo in Kursk oblast was destroyed by Ukrainian HIMARS strikes. “




5,338 posted on 08/16/2024 8:32:30 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5337 | View Replies]

To: PIF; All

“700 Russian soldiers are potentially in a “cauldron” in Glushkovo and Glushkovo district.”


5,339 posted on 08/16/2024 8:41:20 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5338 | View Replies]

To: PIF; All

RuZZian Aviation Lost.

Russia - 279, of which: destroyed: 231, damaged: 43, captured: 5

Combat Aircraft (105, of which destroyed: 98, damaged: 7)

3 MiG-31BM fighter aircraft: (1, destroyed in a non-combat related incident) (2, destroyed) (3, destroyed)

33 Su-25 close air support aircraft: (1, destroyed) (2, destroyed) (3, destroyed) (4, destroyed) (5, destroyed) (6, destroyed) (7, destroyed) (8, destroyed) (9, destroyed) (10, destroyed) (11, destroyed) (12, destroyed) (13, destroyed in a non-combat related incident) (14, destroyed) (15, destroyed in a non-combat related incident) (16, destroyed) (17, destroyed) (18, damaged beyond economical repair) (19, destroyed) (20, destroyed) (21, destroyed in a non-combat related incident) (22, destroyed) (23, destroyed) (24, destroyed) (25, destroyed) (26, destroyed) (27, destroyed) (28, destroyed) (29, destroyed) (30, destroyed) (31, destroyed) (1, damaged) (2, damaged)

3 Su-24M strike aircraft: (1, destroyed in a non-combat related incident) (2, destroyed) (3, destroyed)

1 Su-24MR tactical reconnaissance aircraft: (1, destroyed on the ground)

10 Su-24M/MR strike/tactical reconnaissance aircraft: (1, 2, 3 and 4, destroyed on the ground) (5, destroyed in a non-combat related incident) (6, damaged beyond economical repair on the ground) (7, destroyed) (8, destroyed) (1, damaged on the ground) (2, damaged)

2 Su-27 strike aircraft: (1, destroyed) (2, destroyed)

11 Su-30SM multirole aircraft: (1, destroyed on the ground) (2, destroyed) (3, destroyed) (4, destroyed) (5, destroyed) (6, 7 and 8, destroyed on the ground) (9, destroyed) (10, destroyed) (11, damaged beyond economical repair on the ground)

31 Su-34 strike aircraft: (1, destroyed) (2, destroyed) (3, destroyed) (4, destroyed) (5, destroyed) (6, destroyed in a non-combat related incident) (7, destroyed) (8, destroyed) (9, destroyed) (10, destroyed) (11, destroyed) (12, destroyed in a non-combat related incident) (13, destroyed) (14, destroyed) (15, destroyed) (16, destroyed in a non-combat related incident) (17, destroyed) (18, destroyed) (19, destroyed) (20, destroyed) (21, destroyed in a non-combat related incident) (22, 23 and 24, destroyed) (25, destroyed) (26, destroyed) (27, destroyed) (28, destroyed) (29, destroyed) (1 and 2, damaged)

1 Su-34M strike aircraft: (1, destroyed)

7 Su-35S multirole aircraft: (1, destroyed) (2, destroyed)
(3, destroyed) (4, destroyed) (5, destroyed) (6, destroyed) (7, destroyed)

1 Su-57 Stealth multirole fighter: (1, damaged)

2 Unknown fighter jet: (1, destroyed) (2, destroyed)

Strategic Bombers (5, of which destroyed: 3, damaged: 2)

4 Tu-22M3 strategic bomber: (1, destroyed) (2, destroyed) (3, destroyed) (1, damaged on the ground)

1 Tu-95MS strategic bomber: (1, damaged on the ground)

Command And Control Aircraft (5, of which destroyed: 4, damaged: 1)

3 Il-22(M) airborne command post: (1, destroyed) (2, damaged beyond economical repair) (1, damaged)

2 Beriev A-50: (1, destroyed) (2, destroyed)

Transport Aircraft (8, of which destroyed: 6, damaged: 2)

1 Beriev Be-200 amphibious flying boat: (1, damaged)

1 An-26 transport aircraft: (1, destroyed in a non-combat related incident)

6 Il-76 transport aircraft: (1 and 2, destroyed on the ground) (3 and 4, damaged beyond economical repair on the ground) (5, destroyed) (1, damaged on the ground)

Helicopters (141, of which destroyed: 109, damaged: 30, captured: 2)

35 Mi-8 transport helicopter: (1, destroyed) (2, destroyed) (3, destroyed) (4, destroyed in a non-combat related incident) (5, destroyed) (6 and 7, destroyed on the ground) (8 and 9, destroyed on the ground) (10, abandoned and destroyed) (11, destroyed) (12, destroyed) (13, destroyed) (14, destroyed) (15, destroyed) (16, destroyed) (17, destroyed) (18, destroyed) (19, destroyed) (20, destroyed) (21 and 22, destroyed on the ground) (23, destroyed) (24, destroyed) (1, damaged on the ground) (2, 3, 4, 5, 6 and 7, damaged on the ground) (8 and 9, damaged on the ground) (10, damaged) (1, defected and captured)

6 Mi-8MTPR-1 electronic warfare helicopter: (1 and 2, destroyed) (3 and 4, destroyed) (5, destroyed) (1, damaged)

4 Mi-24P attack helicopter: (1, destroyed) (2, destroyed) (3, destroyed) (4, destroyed)

4 Mi-24V/P/35M attack helicopter: (1, destroyed) (2, destroyed) (1, damaged on the ground) (2, damaged on the ground)

10 Mi-35M attack helicopter: (1, destroyed) (2, destroyed) (3, destroyed) (4, destroyed) (5, destroyed) (6, destroyed) (7, destroyed) (8, destroyed) (9, destroyed) (1, damaged on the ground)

14 Mi-28 attack helicopter: (1, destroyed) (2, destroyed) (3, destroyed on the ground) (4, destroyed) (5, destroyed) (6, destroyed) (7, destroyed) (8, destroyed) (9, destroyed) (10, destroyed) (1 and 2, damaged on the ground) (3 and 4, damaged on the ground)

1 Ka-29 naval attack helicopter: (1, destroyed)

61 Ka-52 Alligator attack helicopter: (1, destroyed in a non-combat related incident) (2, destroyed) (3, destroyed) (4 and 5, destroyed on the ground) (6, destroyed) (7, destroyed) (8, destroyed) (9, destroyed) (10, destroyed) (11, destroyed) (12, destroyed) (13, destroyed) (14, damaged, abandoned and later destroyed) (15, damaged, abandoned and later destroyed) (16, destroyed) (17, destroyed) (18, destroyed) (19, destroyed) (20, destroyed) (21, destroyed) (22, destroyed) (23 and 24, destroyed on the ground) (25, destroyed) (26, destroyed) (27, destroyed) (28, destroyed) (29, destroyed) (30, destroyed) (31, destroyed) (32, destroyed) (33, destroyed) (34, destroyed) (35, destroyed) (36, destroyed) (37, destroyed) (38, destroyed) (39, destroyed) (40, 41, 42, 43, 44 and 45, destroyed on the ground) (46, destroyed) (47, destroyed) (48, destroyed) (1 and 2, damaged on the ground) (3, damaged) (4, damaged) (5, 6, 7 and 8, damaged on the ground) (9, 10, 11 and 12, damaged on the ground) (1, damaged and captured)

6 Unknown helicopter: (1, 2 and 3, destroyed on the ground) (4, 5 and 6, destroyed on the ground)

Unmanned Combat Aerial Vehicles (15, of which destroyed: 11, damaged: 1, captured: 3)

6 Orion: (1, destroyed) (2, destroyed) (3, destroyed) (4, destroyed) (5, destroyed) (6, destroyed)

1 Korsar: (1, destroyed)

1 Forpost-RU: (1, destroyed)

3 Mohajer-6: (1, destroyed) (2, destroyed) (1, damaged)

3 Orlan-10 UCAV: (1, destroyed) (1, captured) (2, captured)

1 Eleron T-16: (1, captured)


5,340 posted on 08/16/2024 8:56:57 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5339 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,301-5,3205,321-5,3405,341-5,360 ... 6,421-6,433 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson