Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,161-16,18016,181-16,20016,201-16,220 ... 22,381-22,386 next last
To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

Russia begins to open a third front in its war on the West

[ Romania Slams Down Russian Drones and Missiles! ]

Today [ May 25 ], there is interesting news from the Black Sea region. Here, after numerous Russian provocations, Romania was forced to take drastic measures to counter Russian incursions into its airspace. Coordinating with NATO allies and using Ukraine’s naval strike capabilities, the countries around the Black Sea are now working to nullify Russian threats.

After repeated Russian drone incursions into its airspace, Romania has had enough. Acting decisively, the country’s interim President, Ilie Bolojan, signed into law a bill allowing the Romanian military to shoot down unauthorized drones that violate its national airspace. This landmark legislation, initially drafted in October following a series of Russian drone crashes in Romanian territory, represents Romania’s firm commitment to countering Russian provocations that have increasingly threatened civilian areas near the border.

Romania, which shares a 600-kilometer frontier with Ukraine, has seen multiple Russian drones enter and even crash inside its territory, while targeting Ukrainian infrastructure in Odesa Oblast. Though there is no evidence these were deliberate attacks on Romania, the danger and Russia’s willingness to risk Romanian casualties. remain real.

The new law sets clear conditions under which unmanned aircraft may be neutralized, with any drone entering Romanian airspace, without authorization now to be destroyed after identification. Last time in March, another Russian drone crashed in Romania, near the Ukrainian settlement of Reni, proving that Russian operations are pushing dangerously close to NATO territory. These incursions are widely seen as attempts to test NATO’s resolve and gradually blur the red lines around the alliance’s boundaries.

Romania’s firm stance has international backing. The United States has resumed high-altitude surveillance flights over the Black Sea, with the powerful RQ-4B Global Hawk surveillance drone now flying again. These strategic intelligence-gathering flights, launched from NATO’s Sigonella Air Base in Sicily, can last over 30 hours and sweep vast swaths of land and sea.

These drones are equipped with advanced sensors capable of detecting ground and naval targets with precision, allowing real-time updates to both Romania and Ukraine. The resumption of such flights signals a broader U.S. shift after a long pause following Donald Trump’s return to office. While British and French assets had filled the surveillance gap, American assets are now again visibly asserting their presence over NATO’s southeastern flank.

This renewed support is not just for show. It directly contributes to real-world battlefield outcomes. Recently, Ukraine’s Security Service launched a successful naval drone strike against a Russian radar installation on an abandoned oil rig in the Black Sea. Likely aided by U.S. reconnaissance data, the strike neutralized Russian early-warning capabilities, used to monitor both Ukrainian and allied aerial activity, including American drones.

These installations also helped Russia detect and intercept Ukrainian drone and missile strikes aimed at Crimea. The destruction of this radar platform not only enhances Ukraine’s strike potential, but also removes a tool Russia could use to track or provoke NATO aircraft, something Moscow has attempted before, through dangerous interceptions.

Romania’s position is uniquely sensitive, and the measures reflect a wider pattern. Not only does it border Ukraine and share the Black Sea with Russia, but it also hosts vital NATO infrastructure. Its ports and airfields are increasingly being used for alliance logistics and surveillance. Russian provocations here risk both confrontation and accidental escalation. By taking firm control of its airspace and welcoming enhanced allied reconnaissance, Romania is becoming a central pillar of Black Sea security.

As Russia continues to provoke NATO’s eastern flank through airspace violations, electronic warfare, sabotage, and hybrid border destabilization, more member states are taking serious action. Romania joins a growing list of countries making significant defense decisions in response to Russian threats. The law to shoot down drones not only strengthens Romanian sovereignty, but may also inspire similar legislation in other NATO countries bordering Russia or Belarus.

Overall, Russia’s continued provocations have triggered a domino effect across Eastern Europe. Romania, long on the defensive, is now actively strengthening its posture. With NATO surveillance efforts back in full swing and Ukraine intensifying its naval capabilities, Romania is not just protecting itself, it’s contributing to a regional security framework, designed to deter Russian aggression. Romania’s actions mark a new phase of firmness and preparedness on the alliance’s southeastern flank to enforce NATO interests more powerfully.

https://www.youtube.com/watch?v=qBvm_2NWxLw


16,181 posted on 05/25/2025 1:18:40 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16175 | View Replies]

To: PIF; BeauBo; FtrPilot; All

Russia strategic bombers airborne and on their way to the launch lines for another mass cruise missile attack on Ukraine.


16,182 posted on 05/25/2025 2:21:47 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 16181 | View Replies]

To: PIF

Your posts aren’t yours, it’s open source material and after three years of this iobscene war absolutely nothing has changed including your walls of text. Take a deep breath 😮‍💨 and remember; Donald Trump wants peace ☮️ not war.


16,183 posted on 05/25/2025 2:22:02 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16180 | View Replies]

To: PIF

“after three years of this iobscene (sic) war absolutely nothing has changed”

Well there are those million Russian casualties, the emptying of it’s National Wealth Fund, the scrapping of the old Soviet arsenal, Russia becoming the most sanctioned pariah nation on Earth; and the end of personal, press or political freedom in Russia.


16,184 posted on 05/25/2025 4:11:22 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16180 | View Replies]

To: BeauBo

lol that had to hurt 😂


16,185 posted on 05/25/2025 4:45:54 PM PDT by blitz128
[ Post Reply | Private Reply | To 16184 | View Replies]

To: blitz128; PIF; BeauBo
Your Zelensky seems to be off his chain

🚨BREAKING: Ukraine has reportedly just tried to assassinate Russian President Vladimir Putin with a Drone Strike on Putin's helicopter. pic.twitter.com/Pkbw1NpVWz— Publius (@OcrazioCornPop) May 25, 2025


16,186 posted on 05/25/2025 5:35:38 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16185 | View Replies]

To: blitz128

Putin is a legitimate Military target. If anyone on Earth deserves it, he certainly does.


16,187 posted on 05/25/2025 6:23:40 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16185 | View Replies]

To: BeauBo

Seems pitin is off his chains, and President Trump has recognized that. Cue the finger meme😎


16,188 posted on 05/26/2025 3:14:09 AM PDT by blitz128
[ Post Reply | Private Reply | To 16187 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, May 25, 2025

Russian President Vladimir Putin is leveraging long-range strikes against Ukrainian cities, aggressive rhetorical campaigns, and excessive pessimism in the West about the battlefield situation in Ukraine in a multi-pronged effort to degrade Ukrainian morale and convince the West that a Russian victory in Ukraine is inevitable and that supporting Ukraine is futile. Russian forces have intensified long-range strikes against Ukraine over the last eight months and have conducted seven of the largest drone and missile strikes during the war to date since January 2025.[1] Russian officials are currently inundating the information space with calls for Ukraine to make concessions on its sovereignty and territorial integrity, although most of these statements are consistent with long-standing Russian war demands and in fact demonstrate that Russia's demands have not changed over the last three years of war.[2] These demands ignore the fact that the battlefield situation has shifted dramatically since early 2022, and that three years of manpower and materiel losses have significantly degraded the Russian military's ability to conquer Ukraine. Russian advances have significantly slowed as Russian forces continue to suffer personnel losses and increasingly rely on poorly trained and equipped infantry to make gains. Putin remains deeply committed to distracting from the realities of the battlefield situation, however, as bringing about the cessation of Western military assistance to Ukraine is Russia's only real hope of winning this war.

Russian forces conducted the largest combined drone and missile strike of the war against Ukraine on the night of May 24 to 25. The Ukrainian Air Force reported on May 25 that Russian forces launched nine Iskander-M and Kn-23 ballistic missiles from Kursk Oblast, 55 Kh-101 and Kalibr cruise missiles from Saratov Oblast and the Black Sea, one Kh-22 cruise missile from the airspace over the Black Sea, and four Kh-59/69 cruise missiles from an unspecified area of Russia and 298 Shahed and decoy drones from the direction of Bryansk, Kursk, and Oryol cities; Millerovo, Rostov Oblast; and Primorsko-Akhtarsk, Krasnodar Krai.[3] The Ukrainian Air Force reported that Ukrainian forces shot down 45 cruise missiles and that two Kh-59/69 missiles were “lost in location.” The Ukrainian Air Force reported that Ukraine shot down 139 drones and that 127 drones were “lost.” Ukrainian officials reported that the Russian strike primarily targeted Kyiv and Chernihiv oblasts and also targeted Zhytomyr, Khmelnytskyi, Ternopil, Sumy, Odesa, Poltava, Dnipropetrovsk, Mykolaiv, Kharkiv, and Cherkasy oblasts.[4] Ukrainian officials reported that the strikes killed at least 12 people and injured up to 60 people.[5]

Ukrainian sources noted on May 25 that Russian forces are increasingly launching missiles from occupied Crimea after using missiles less frequently over the last five months.[6] Ukrainian Main Directorate of Intelligence (GUR) Spokesperson Andriy Chernyak reported that Russian forces have launched more than 50 missiles from mobile missile systems in occupied Crimea since January 1, 2025. Chernyak stated that Ukrainian Forces struggle to strike the mobile missile launch systems since Russian forces can deploy the systems in 20 minutes and quickly break down and move the systems after a launch. Experts familiar with the topic reported that Russian forces have been launching Iskander ballistic missiles, Oniks supersonic anti-ship cruise missiles, and Zircon hypersonic cruise missiles from Crimea. ISW assessed on May 24 that Russian forces have used fewer cruise missiles in strike packages since January 2025, likely due to increased reliance on cheaper long-range drones.[7] The May 24 to 25 overnight combined strike indicates that Russia may be stockpiling cruise missiles in order to conduct large-scale combined strikes against multiple areas of Ukraine at will. Russia may also be using highly varied strike packages in order to confuse Ukrainian forces and prevent Ukrainian forces from conducting consistently effective air defense.

Russian Security Council Deputy Chairperson Dmitry Medvedev suggested that Russia will occupy most of Ukraine if the West continues to aid Ukraine. Medvedev called for Russian control over a buffer zone encompassing nearly all of Ukraine, apart from a relatively small area of Volyn and Lviv oblasts along Poland's border, on his English-language social media accounts on May 25 and threatened that Russia will seize virtually all of Ukraine as a buffer zone if the West continues to supply Ukraine with military aid.[8] Medvedev and other Russian officials have repeatedly called for Russia to establish buffer zones in northern Ukraine, and Medvedev himself previously called for Russia to occupy most of Ukraine as a “buffer zone” in order to place Russian cities out of the range of Ukraine's Western-provided long-range strike systems. Russian officials routinely issue demands for Ukraine to concede significant swaths of occupied and unoccupied territory to Russia and have used Russia's illegal annexation of Donetsk, Luhansk, Zaporizhia, and Kherson oblasts and Crimea and the Kremlin-generated concept of “Novorossiya” — an invented region of Ukraine that Kremlin officials have claimed includes all southern and eastern Ukraine — to justify these claims.[9] Medvedev’s statements are part of a long-term Kremlin strategy to use prominent voices in the information space and weaponized versions of history to justify Russia's aggression against Ukraine and the long-term occupation of Ukrainian territory.[10]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-25-2025

16,189 posted on 05/26/2025 3:24:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16159 | View Replies]

To: blitz128; BeauBo
Day 1,187 of the Muscovian invasion. 1,000 [average is 827/day], i.e. more than 41 Russians and Norks/h. Vehicles and fuel tanks more than 115% and artillery more than 110% above average. Motorcycles are not counted yet.


16,190 posted on 05/26/2025 3:53:59 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16161 | View Replies]

To: PIF; nuconvert
Russia will be able to restore its combat capabilities and launch an aggression against Europe between two and four years after hostilities in Ukraine end, Ukrainian foreign intelligence (SZRU) chief Oleh Ivashchenko said in an interview with Ukrinform published on May 26.

“If the sanctions are lifted, the rearmament process will proceed much faster,” Ivashchenko said in the interview, adding that Kyiv has shared its estimates with European partners. Western officials have previously shared similar time estimates, underscoring the growing threat of an open clash between Moscow and NATO after the Russian full-scale war against Ukraine ends.

Russia's military is currently heavily engaged in Ukraine, suffering massive losses in manpower and equipment. Christopher Cavoli, commander of U.S. forces in Europe, nevertheless warned in April that Russia is rebuilding its forces much faster than previously anticipated. Ukraine's military claims that Russia has suffered close to 1 million men killed, injured, or otherwise listed as casualties since the outbreak of the full-scale war.

Kyiv’s Western partners — namely the U.S. and the EU — have also sought to restrain Russia's ability to reconstitute its forces by imposing heavy sanctions aimed at cutting off supply chains and throttling Moscow's economy. U.S., European, and Ukrainian officials and military experts believe that Russia is losing its military edge on the battlefield, presenting it as an impetus to increase pressure on Moscow and force it toward a ceasefire, the Washington Post reported.

https://kyivindependent.com/russia-can-attack-europe-2-4-years-after-wars-end-faster-with-lifted-sanctions-ukrainian-intel-chief-warns/

16,191 posted on 05/26/2025 3:57:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16190 | View Replies]

Ukrainian drone hunts for Russian Tor air defense system somewhere on the front
https://bsky.app/profile/militarynewsua.bsky.social/post/3lq2veiv3s22l
39 s video


16,192 posted on 05/26/2025 4:13:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16191 | View Replies]

To: blitz128; PIF; BeauBo
Кремлевская табакерка

The Kremlin announced an assassination attempt on Putin in the Kursk region.

It was hardly an accident that Vladimir Putin's helicopter ended up in the epicenter of an attack by enemy drones during the president's visit to the Kursk region. This incident should be considered an assassination attempt on Vladimir Vladimirovich, which was carried out by Russia's internal enemies. This is the opinion expressed by our source in the Kremlin. “Many people are talking about this, but everyone is afraid to speak out openly. I am not afraid. I am sure that they wanted to deliberately expose Vladimir Vladimirovich's helicopter to enemy drones or our air defense so that it would crash. It simply could not be otherwise!” he is sure.

Our interlocutor blames “internal enemies who have gotten their hopes up and are hoping that the SVO will soon end and they will again live as before” for the assassination attempt on Putin. “They think that if Vladimir Vladimirovich is gone, they will come to an agreement with the West on everything or with the Kiev regime, lift sanctions and live happily ever after. They are hoping in vain, nothing will work out for them!” the source added. And he believes that the security forces will sort out the situation, and all those responsible will be punished very harshly. It should be noted that our interlocutors in the Church had previously hinted at the threat of an assassination attempt on the president. The Russian Orthodox Church even increased prayers for Putin to provide him with additional protection.

At the same time, sources in the FSB and FSO note that there were “some signals” about a possible assassination attempt on Vladimir Vladimirovich. But “none of them received sufficient confirmation.”

https://t.me/kremlin_secrets/5715


You don't fly in a war zone with a VIP.

16,193 posted on 05/26/2025 4:48:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16192 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...
Belarus has nuclear weapon delivery systems but no Russian warheads, Ukrainian intel chief says

Belarus possesses nuclear weapon delivery systems but no warheads, Ukrainian foreign intelligence (SZRU) chief Oleh Ivashchenko said in an interview with Ukrinform published on May 26. Belarus has been a key ally to Moscow and has previously been reported as hosting Russian tactical nuclear arms on its territory, after the two countries signed an agreement in May 2023.

Belarusian dictator Alexander Lukashenko said in December of the same year that the transfer of Russian nuclear weapons to Belarus was completed in early October. But according to Ivashchenko, at the present time Belarus does not possess any nuclear weapons.

Russian President Vladimir Putin has repeatedly made nuclear threats against Ukraine and the West since the beginning of the full-scale invasion in February 2022.

https://kyivindependent.com/belarus-has-nuclear-weapon-delivery-systems-but-no-russian-warheads-ukrainian-intel-chief-says/

Only a fraction of the Russian nuclear arsenal is operational.

16,194 posted on 05/26/2025 4:55:54 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16193 | View Replies]

To: AdmSmith
"Only a fraction of the Russian nuclear arsenal is operational."

Maintaining a nuclear arsenal is incredibly expensive.
Current estimates are nearing $100 billion per year for US nukes -- that includes operations, maintenance & modernization.

Estimates of Russia's nuclear maintenance expenses run in the $10 billion per year range, suggesting that many Russian warheads are in less-than-optimal condition.

16,195 posted on 05/26/2025 5:56:56 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 16194 | View Replies]

To: BroJoeK; AdmSmith
"Only a fraction of the Russian nuclear arsenal is operational."

More Neocon gossip? Substantiate this comment.

16,196 posted on 05/26/2025 6:23:40 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16195 | View Replies]

To: AdmSmith
Ukrainian drone operators from Madyar's Birds destroyed a Russian BMP-2 equipped with loose wire to counter drones. It seems the engineering innovation failed to protect the vehicle.

https://x.com/wartranslated/status/1926229551094304858

Reports claim a Russian BMP-2, covered with wire fragments, is shown in a photo as protection against Ukrainian FPV drones.


16,197 posted on 05/26/2025 6:24:57 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 16194 | View Replies]

To: blitz128
💥 SBSU unit "Shkval" destroyed Russian equipment in Luhansk region!

https://x.com/Maks_NAFO_FELLA/status/1926986248649908672


16,198 posted on 05/26/2025 6:27:12 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 16197 | View Replies]

To: BeauBo; PIF; BroJoeK; blitz128; AdmSmith
Putin is a legitimate Military target

It isn't surprising that you Ukranian psychos believe presidents are legitimate military targets, after all this guy tried to kill Trump.


16,199 posted on 05/26/2025 6:28:22 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16187 | View Replies]

To: JonPreston
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )

16,200 posted on 05/26/2025 6:29:06 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16199 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,161-16,18016,181-16,20016,201-16,220 ... 22,381-22,386 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson