Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,401-15,42015,421-15,44015,441-15,460 ... 22,021-22,025 next last
To: gleeaikin

Russian Offensive Campaign Assessment, May 3, 2025

The Trump administration appears to have finalized its first military equipment sale to Ukraine. The US Defense Security Cooperation Agency (DSCA) announced on May 2 that the US State Department approved and notified the US Congress of a possible Foreign Military Sale (FMS) of equipment and maintenance services for Ukraine’s F-16s worth an estimated $310.5 million.[8] The DSCA reported that the sale will include aircraft modifications and upgrades; personnel training related to operation, maintenance, and sustainment support; spare parts, consumables, and accessories; repair and return support; ground handling equipment; classified and unclassified software delivery and support; classified and unclassified publications and technical documents; studies and surveys; and US Government and contractor engineering, technical, and logistics support services.

Ukrainian forces shot down a Russian fixed-wing aircraft with a surface-to-air missile (SAM) attached to a naval drone for the first time on May 3. Ukrainian forces launched an aerial drone, a naval drone, and missile strike against Novorossiysk, Krasnodar Krai, and surrounding areas on May 3.[9] The Ukrainian Main Military Intelligence Directorate (GUR) confirmed that Ukrainian forces used a SAM fired from a Magura naval drone to down a Russian Su-30 fighter jet over the Black Sea near Novorossiysk.[10] Ukrainian forces used missiles attached to a Magura naval drone to shoot down a Russian Mi-8 helicopter in December 2024, but this is the first time that Ukrainian forces have downed a fixed-wing aircraft using this tactic.[11]

Russian milbloggers responded to the May 3 strike, claiming that Russia is lagging behind Ukraine on naval drone development and complaining that Russia has previously lost aircraft over the Black Sea due to Ukrainian drone dominance.[12] The milbloggers claimed that Russian forces have the means to combat Ukrainian naval drones and protect Russian aircraft from missile strikes, but that Russian leadership is unwilling to prioritize Russian drone development and innovation. The milbloggers called for Russian coastal defense units and drone operators in the Black Sea to integrate lessons learned from Russian infantry fighting in Ukraine in order to integrate first-person view (FPV) drones with aerial reconnaissance.

Senior Kremlin officials continue to set informational conditions that could support military operations against Lithuania (and other NATO states) by advancing narratives that deny the sovereignty of Lithuania and other former Soviet states. Independent Russian media outlets Meduza and Agentstvo reported on May 2 that Russian Foreign Minister Sergei Lavrov authored the foreword of a new book titled “History of Lithuania,” which the “Foreign Relations” publishing arm of the Moscow State Institute of International Relations (MGIMO) published in March 2025.[13] Lavrov‘s foreword claimed that the national policies of Baltic countries, including modern Lithuania, leverage “falsified” historical narratives to “stimulate” Russophobic and anti-Russian sentiments in their domestic audiences.[14] Lavrov claimed that the book seeks to analyze the development of the “lands that were associated with Lithuania at different times.” Lithuanian Foreign Minister Kęstutis Budrys stated that the book is a Russian propaganda tool designed to provide the Kremlin with scholarly literature to support its denial of neighboring countries’ statehoods and histories separate from that of Russia.[15] Kremlin officials, including Russian President Vladimir Putin, have recently intensified their threats against Europe — particularly the Baltic States — due to Europe’s alleged “Russophobia.”[16] Kremlin officials have also indicated that Russia views independent states that were once part of the Russian Empire and Soviet Union as part of modern-day Russia.[17]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-3-2025


15,421 posted on 05/03/2025 11:13:03 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15385 | View Replies]

To: blitz128
Putin Admits He Constantly Fights the Desire to “Punch” Someone

President Vladimir Putin, in a conversation with VGTRK reporter Pavel Zarubin, admitted that he constantly feels the desire to “punch” someone, but keeps himself under control.

Zarubin posted a fragment from a documentary about Putin's 25 years in power, which will be shown on Rossiya 1 on May 4, on his Telegram channel. In the video, the journalist talks about the president's outward composure and restraint and asks: “Doesn't there ever feel like, as they say, punching someone?” “Always. I live with it, but I fight it,” Putin replies.

Putin also drew a parallel with his childhood in Leningrad. “50 years ago, the streets of Leningrad taught me one rule: if a fight is inevitable, you have to hit first,” he said in the fall of 2015.

Deputy Prime Minister Marat Khusnullin said in 2020 that if his subordinates are dissatisfied, Putin does not scold them, but calmly points out the mistakes they made, but “then you can't sleep at all.” The president himself said that same year that he keeps his subordinates “under administrative pressure and stress” in order to improve the quality of their work.

https://www.rbc.ru/politics/03/05/2025/6815d8529a794797480a1649

2 min video (Russian)

15,422 posted on 05/03/2025 11:38:31 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15420 | View Replies]

To: BeauBo
Russia's wars run on oil. Not metaphorically—literally.

Every tank shell, every drone, every missile barrage is funded by the price per barrel. And every ceasefire or “peace negotiation” is not a step toward peace, but a strategic pause for rearmament, perfectly timed with a drop in oil revenue.

Let's rewind to 2014. Russia invaded Crimea in February. Brent crude was at $110 a barrel. Flush with oil wealth, the Kremlin launched its hybrid war in eastern Ukraine, annexed territory, and bankrolled proxy forces.

But as oil prices slid through 2014 and 2015—crashing to $60 by February 2015 and then plummeting to $30—the Russian war machine began to seize up. Western sanctions bit hard, but it was the collapse in oil revenue that broke Moscow's appetite for full-scale war. The ruble tanked, the dollar exchange rate doubled, and $150 billion evaporated from Russia's reserves. GDP stalled, then shrank.

And suddenly—surprise—Russia agreed to Minsk-2. Not because Putin found religion, but because Brent fell.

This is the pattern: high oil prices fund invasions; low prices trigger pauses disguised as diplomacy. And the West falls for it—every time. Minsk-2. The Sochi deals. The “Easter truces.” Each one a lie, each one timed to budgetary limits, not moral calculations.

Now in 2024–2025, we're watching the same cycle. Russia stalls negotiations, pushes ceasefire narratives, and waits. Because Brent is volatile, and they know how to ride the wave. Every pause is just the calm before more missiles.

It's time Western leaders stopped treating Kremlin diplomacy as genuine. The only honest map of Moscow's intentions is an oil price chart.

https://kyivinsider.com/oil-war-and-western-amnesia-how-the-kremlin-buys-time-to-reload/

15,423 posted on 05/04/2025 12:02:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15409 | View Replies]

To: marcusmaximus; AdmSmith; BeauBo; FtrPilot; blitz128; PIF; SpeedyInTexas; MalPearce; Widget Jr; ...

Despite many efforts, Russia continues to fight through the various sanctions and limits the US and others have put in place to prevent the more effective pursuit of their war. This analysis and examples of sanctions evasion schemes used by Russian military-industrial complex groups should be of great interest to some who frequent this thread:

InformNapalm
https://informnapalm.org/en/in-the-shadow-of-sanctions/

“This analytical article contains documents, analysis and examples of typical sanctions dodging schemes used by Russian suppliers of the Russian military-industrial complex. Here, you will find names of numerous Russian companies and plants involved in sanctions evasion schemes, learn what typical forgeries Russians resort to in invoices and other documents to conceal supply routes and identifying data of suppliers providing access to Western products. This article provides extensive context so that every reader could follow the logic of the investigation and understand how the Russia finds its way around sanctions. This information can come handy to both experts specializing in sanctions and investigative journalists who can conduct their own investigations on sanctions. Exposing the sanctions evasion schemes and disrupting the logistics of the Russian military-industrial complex makes the Russian army less equipped, which converts into saving the lives of Ukrainian military and civilians and bringing the victory over the aggressor closer.” It is expecially concerning to see how even countries we consider our friends, like Germany, have people who defy the sanctions for their own greed.

In


15,424 posted on 05/04/2025 12:06:50 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 15416 | View Replies]

Day 1,165 of the Russian invasion. 1,340 [average is 821/day], i.e. more than 55 Russians and Norks/h. Vehicles and fuel tanks more than 215% and artillery more than 120% above average. Motorcycles are not counted yet.


15,425 posted on 05/04/2025 1:09:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15389 | View Replies]

To: AdmSmith
2 planes i.e. more than 525% above average ;-)
15,426 posted on 05/04/2025 1:12:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15425 | View Replies]

To: marcusmaximus
Even the clown Lukashenko will be “late” and most likely won't even attend the May 9 parade in Moscow. Perhaps it has something to do with the weather forecast for May 9 - we never know.

🇮🇳❌ April 30: Modi has cancelled his trip to Moscow for the parade. It has been announced that Indian Defense Minister will come instead.

🚫 May 3: Indian Defense Minister has cancelled his trip to Moscow for the parade….

https://bsky.app/profile/maks23.bsky.social/post/3lobnibw2w22e

15,427 posted on 05/04/2025 3:38:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15416 | View Replies]

To: SpeedyInTexas
Walking around Novosibirsk can be dangerous.

A piece of the facade fell onto the sidewalk on Krasny Prospekt 35. Eyewitness Andrei Fedorov managed to film the moment of the collapse, he himself was slightly hit by fragments, reports KP Novosibirsk.

https://x.com/SibirPost/status/1918920635318763850
17 s video

15,428 posted on 05/04/2025 3:44:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15427 | View Replies]

To: AdmSmith

I would say that Russias actions past and present fully support any form of “Russophobia “


15,429 posted on 05/04/2025 3:59:06 AM PDT by blitz128
[ Post Reply | Private Reply | To 15421 | View Replies]

To: AdmSmith

That’s one stronk gutter😎


15,430 posted on 05/04/2025 4:02:17 AM PDT by blitz128
[ Post Reply | Private Reply | To 15428 | View Replies]

To: blitz128

Fear sells, always has, always will. Americans like to use a Boogieman. First it was the British and Native Americans, then it was rebellious slaves, The Asians, European Communists, None look to the real enemies, liberal Judges.


15,431 posted on 05/04/2025 4:04:06 AM PDT by Forward the Light Brigade (. War is Hell, War IS a Crime.)
[ Post Reply | Private Reply | To 15429 | View Replies]

To: gleeaikin

Stop your idiotic gloom and doom BS....
Zeepers long awaited sh*t show is a-happening!
Mark your calenders and book your flights to the wonderful war torn city of Kiev for the
most prominent annual LGBTQ+ event in the country – LMAO! 😂😂😂😂🤣

https://kyivpride.org/en/

Btw General Granny, on May 9th, the little homo’s dictatorship will expire once again.
So will he finally let the martial law and general mobilization extension expire and allow the Ukrainian people the elections they deserve or will the greedy, grifting, midget sign another 90 day extension of his dictatorship???
What say you, the computer war game, know-it-all armchair wanne-be general ?


15,432 posted on 05/04/2025 4:23:40 AM PDT by ANKE69 ( 🇺🇲 Let's MAGA 🇺🇲)
[ Post Reply | Private Reply | To 15424 | View Replies]

That would be the 14th extension !!!!
15,433 posted on 05/04/2025 4:27:40 AM PDT by ANKE69 ( 🇺🇲 Let's MAGA 🇺🇲)
[ Post Reply | Private Reply | To 15432 | View Replies]

To: AdmSmith

Maria Drutska 🇺🇦 reposted
olexander scherba🇺🇦
@olex_scherba

Russia’s obsession with WWII is stunning. It can’t be explained solely by historic trauma. Ukrainians lost in that war more per capita than Russians. Ukraine’s whole territory was burnt down. Even according to Russian statistics at least 16% of the fallen Soviet soldiers were Ukrainians (with Ukrainians constituting 10% of the USSR population). Ukraine’s trauma was no less - yet modern Ukraine has never been as WWII-obsessed as Russia. So, what is the nature of this phenomenon?

First, it has to do with Russia’s craving for “greatness”. An average Russian looks at the map, sees how large Russia is, and automatically thinks: because it is large, it must be great. The problem is: there’s very little great about today’s Russia. No great ideas, no great industry, no global inspiration. Russia is a pariah, not a leader. Even their acclaimed culture isn’t that great anymore. Tchaikovsky, Tolstoy - it’s all in the past.

So, to satisfy the craving for greatness, a Russian turns to the past. And finds the next best thing: we won the World War Two. The fact that “we” included other peoples of former Soviet Union, let alone Americans and Brits, is ignored. Just like the inhumane, botched-up price the Soviet people had to pay for the victory due to the inhumane, botched-up character of Stalin’s regime. Just like the atrocities incurred by the Red Army on other nations in the process of Europe’s “liberation”.

What remains is a half-truth: 80 years ago, Russia (in reality, USSR) gave the world something great - defeated fascism. Hence - hurray! - today’s Russia is great. It’s a nation idolizing the past. Which, as we all know from Umberto Eco, is one of the key elements of fascism. Which, in turn, brings us to the crazy paradox: a nation that claims to be “anti-fascist”, conducts a deeply fascist, colonial war on its neighbor.

Second, the idea that they “defeated fascism” gives them the sense of imperial superiority. And the right to declare whoever they want fascist and kill them on the spot. For instance, anybody in Ukraine. Even if it’s millions of people. They view anyone who opposes their occupation a Nazi. Which means, absolute majority of Ukrainian population.

I know, it’s common in the West to view the Putin-Hitler parallels as faux pas. I understand the logic, unless… Unless your nation can actually draw these parallels - because it had direct experience with both. Like in Ukraine’s case.

Ukraine, 80 years ago burnt to the ground by Hitler, is now getting burnt to the ground by Putin. The entire backdrop of this war - with Putin’s constant security demands, with western leaders traveling to Putin and begging him not to do it, with Russia’s arrogant ultimatums in response - is one big uncanny reminder that history rhymes. Let alone the barbarity of what Russians did and do in Ukraine.

So, in case you plan to congratulate Russians on the “Great Victory Day” this year, keep in mind: it won’t be some harmless, apolitical gesture. You will encourage a fascist power amid a fascist war to do more fascist things, disguised as anti-fascism. You won’t be building bridges. You’ll encourage Russia to burn more of them in its insane, fanatical frenzy.

https://x.com/olex_scherba/status/1918288666796908770


15,434 posted on 05/04/2025 4:28:29 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15428 | View Replies]

To: Forward the Light Brigade

Sounds like a universal condition


15,435 posted on 05/04/2025 4:32:47 AM PDT by blitz128
[ Post Reply | Private Reply | To 15431 | View Replies]

To: blitz128

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Kim Jong-Un Goes All-In! Massive Redeployment From Kursk to Donbas! ]

Today [ May 2, 8 pm ], there are a lot of interesting updates from the Russian Federation. Here, for the first time, Russia and North Korea have openly acknowledged direct North Korean military involvement in the war. With increasing Russian pressure on their eastern front, the Ukrainian command are expecting North Korean troops to be deployed to the frontline in eastern Ukraine very soon.

The military cooperation between North Korea and Russia has significantly developed since the start of the war. The North Koreans provided Russians with between 4 and 8 million artillery shells and other heavy equipment, as approximately 1 in 2 artillery shells fired by Russian forces is of North Korean origin. As it is well known, North Korea also sent up to 12,000 soldiers for frontline combat operations in the Kursk region, with an additional 3,000 replacements earlier this year.

Previously, both Russia and North Korea staunchly refused to admit their deployment of North Korean troops in the war. However, recently, both Russian and North Korean sources admitted the direct involvement of North Korean soldiers in Kursk. Russia’s Chief of General Staff, Gerasimov, praised the North Korean soldiers for their supposed high level of professionalism during battles near Kursk, thanking them for their assistance during the Russian counteroffensive.

And in a dramatic address, Kim Jong-Un also confirmed the direct participation of North Korean forces in the war, publicly honoring fallen soldiers as heroes and promising state recognition for their sacrifice, including erecting a monument for them in Pyongyang.

Ukrainian soldiers have noted that North Korean soldiers are indeed well-disciplined and skilled soldiers to fight against individually. However, their tactics, doctrine, and practices were outdated and severely lacking, resulting in a nearly 40% casualty rate in the first 3 months of their deployment.

As Russian forces have largely pushed Ukrainians out of Kursk, save for an approximate 40 square kilometers strip of land along the border, many military analysts state it is highly likely that North Korean soldiers won’t be sent back to North Korea. Andrii Kovalenko, a senior member of the Ukrainian national defense and security council, stated that Russians are preparing to send their available North Korean contingent to the frontline in eastern and southern Ukraine, wearing Russian uniforms.

Russia plans to justify deploying North Korean forces to occupied territories by citing their annexation under Russian law, recognized only by North Korea, allowing Pyongyang to claim to be defending its ally’s borders without formally declaring war on Ukraine.

Unfortunately for Russians, Ukrainians seem to be delaying this redeployment, putting the Russian high command once again in front of a painful dilemma. The North Korean contingent has been integrated and fighting together with several key Russian units. However, many of these Russian units are currently preoccupied with containing the Ukrainian Belgorod incursion, and cannot be redeployed with the North Koreans.

If Russian commanders decide to redeploy the North Koreans without their Russian comrades, this would lead to high losses for both the redeployed North Koreans and the new Russian units supposed to fight with them, due to the would-be lack of proper integration and familiarity. However, if Russian commanders wait too long, the combined Russian and North Korean elements would be thrust into the middle of an ongoing Russian offensive, without the proper time to prepare, again leading to undoubtedly high losses.

Regardless, while North Korean troops were initially extremely inexperienced in the art of contemporary warfare, North Korean soldiers have had to adapt quickly or continue to lose thousands to Ukrainian drones, artillery, and machine guns. This increased skill, though learned at a high cost, in combination with their fanatical conviction on the battlefield, could make the North Koreans an increasingly valuable asset to any Russian commander during the upcoming summer offensives in the east.

Overall, both Russia and North Korea confirmed that North Korean soldiers are and were actively involved in frontline operations in Kursk, raising questions about the possibility of their further deployment to Eastern Ukraine. With the increasing likelihood of a third country directly participating in the war, this escalation could lead to a significant increase in military aid to Ukraine by its allies, especially South Korea, which is more than willing to counter its main adversary both directly and indirectly.

https://www.youtube.com/watch?v=MkBctm4XuAM


15,436 posted on 05/04/2025 5:21:49 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15435 | View Replies]

To: ANKE69; gleeaikin
ANKE69: "Mark your calenders and book your flights to the wonderful war torn city of Kiev for the most prominent annual LGBTQ+ event in the country"

2024 Kiev Pride march:

Kiev is a city of around 3 million.
2024's Pride Day march attracted around 500 people.
No other city in Ukraine attracts even a few dozen Priders.

In the meantime, the US holds Pride Day marches in hundreds of cities each year, some (NYC, Chicago) attracting millions of marchers, others (SF, LA & DC) with hundreds of thousands, and dozens of US cities with tens of thousands of marchers.

ANKE69: "Btw General Granny, on May 9th, the little homo’s dictatorship will expire once again.
So will he finally let the martial law and general mobilization extension expire and allow the Ukrainian people the elections they deserve or will the greedy, grifting, midget sign another 90 day extension of his dictatorship???"

Volodymyr Zelensky is a happily married family man.

Zelensky and his Servant of the People party, unlike your hero Putin, was legitimately elected against strong opposition in 2019.

After Vlad's 2022 invasion, Ukraine's Parliament (as required by its constitution) imposed martial law, for 90 days, extended as necessary.

Next week Ukraine's parliament will decide whether to extend martial law for another 90 days.
By constitutional law it must, while the country is being invaded & occupied by foreign military forces.

If, in the unlikely event, a peace deal with Russia was signed by May 9, that might make a difference, however, when has Vlad the Invader ever kept a promise to keep the peace?

My guess is, it won't happen, and so Ukraine's parliament will extend martial law for another 90 days.

(left) Zelensky & family circa 2019. (right) Russia's invasion continues, 2022:


15,437 posted on 05/04/2025 6:35:37 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 15432 | View Replies]

To: BroJoeK

I have told you more than once not to post to me again.
So how about it ?


15,438 posted on 05/04/2025 6:38:19 AM PDT by ANKE69 ( 🇺🇲 Let's MAGA 🇺🇲)
[ Post Reply | Private Reply | To 15437 | View Replies]

To: BroJoeK

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russians Thought Speed Saves From Exploding Mines! ]

Today [ May 3, 8 pm ], there are a lot of interesting updates from the Toretsk direction. Here, in push to outflank Toretsk from the east, Russian forces turned to motorcycle-mounted assaults across open terrain. However, Ukrainian defenders recalibrated the anti-tank mines to meet the motorcycle charge and turned the flanking attempt into a costly failure before it ever reached the front line.

Russian forces are experiencing many difficulties and suffering high losses, due to their fighting through Toretsk. Because the approach of fighting through the town is rapidly becoming unsustainable, they are seeking an alternative route, hoping to pressure Ukrainian flanks, and force them to withdraw and surrender Toretsk to Russian forces.

Previously, the Russian forces attempted this by assaulting the southern flank of Toretsk around Shcherbynivka, but were pushed back by fighters of the Azov brigade. This is why the Russians decided to try to assault across the northern flank towards Dachne and Dylivka. The terrain here consists primarily of open fields, a railway line, and patches of trees. This setting allows the Russians to conduct mechanized and motorized assaults to use higher maneuverability and heavy armor to their advantage.

For their 1st assault, the Russians accumulated tanks and infantry fighting vehicles in Druzhba, banking on heavy armor to make it across the fields and deploy their infantry. Geolocated combat footage reveals that the Russian column was unusually slow, with Russians transforming their armor into so-called turtle tanks, using wood, rubber, and metal chains to protect themselves from anti-tank kamikaze drones.

However, this resulted in a crawling pace, allowing Ukrainian drones ample time to carefully find weak points in the armor and disable the vehicles with repeated pinpoint strikes.

As the heavy armor, low mobility approach failed, Russian commanders decided to instead deploy mobile units made up of motorbikes to reach the Ukrainian positions in Dylivka. Geolocated footage shows that the 2nd Russian assault group, consisting entirely of motorbike infantry, was able to get much closer to Ukrainian positions than the mechanized assault could; some of them even reaching Ukrainian positions in Dylivka before they could be intercepted by FPV drones.

In the end, it made no difference, as Ukrainians tracked every building the dismounted Russian soldiers had entered and made sure they were eliminated. However, as they mopped up the survivors, Ukrainians realized they had a major vulnerability in their defenses and needed to ensure no further Russian motorbike assaults could come so close to their positions.

The main weakness was that the minefields full of anti-tank landmines, only triggered on heavy vehicles such as cars, armored vehicles, and tanks, making them ineffective against light vehicles such as motorcycles. This is why Ukrainians ramped up the use of anti-personnel and wire-triggered landmines, which can detonate under the light pressure of a soldier’s foot, or in this case, a motorbike’s wheels.

Additionally, Ukrainian sappers modified their self-made mines to also trigger on much lighter weight, recalibrating and fine-tuning the explosives specifically to eliminate Russian motorcycle-based infantry.

During the 3rd and final assault, Russian forces attempted a combined push using both armored vehicles and motorbikes, hoping the combined effort of heavy armor and rapid maneuvers would overwhelm Ukrainian defenders, allowing them to break through. Unfortunately for Russians, as Ukrainian sappers had successfully recalibrated the minefields, Ukrainian drone operators could dedicate their complete focus on swarming and destroying the Russian heavy armor.

Geolocated footage shows that the recalibration had indeed been extremely effective, with Russian motorbikes laying damaged or burning by the side of the road, as Ukrainian drones were easily able to finish off the wounded or surviving riders, after they were flung off their bikes in the explosions.

Overall, the geolocations show that Russians did not even come close to Ukrainian positions, indicating that Ukrainians effectively patched the weakness in their lines, and that they are now stronger for it. The heavily armored turtle tanks, despite not going down in one hit, are often so slow that Ukrainian drones have ample time to swarm them and disable them through repeated strikes.

While the rapid Russian motorcycle assault exposed a weakness in Ukrainian defenses, after Ukrainian sappers recalibrated their mines, Russia’s final push with both heavy armor and bikes collapsed long before it reached Ukrainian lines.

https://www.youtube.com/watch?v=7v5ZPZ2Aoqk


15,439 posted on 05/04/2025 6:42:34 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15437 | View Replies]

To: ANKE69

If you do not want him to post to you, do not post on this thread.


15,440 posted on 05/04/2025 6:59:34 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15438 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,401-15,42015,421-15,44015,441-15,460 ... 22,021-22,025 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson