Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,261-15,28015,281-15,30015,301-15,320 ... 22,001-22,013 next last
To: AdmSmith

Special smoking operation on a Russian ammunition depot many km behind the Pokrovsk front. [Published 27.04.2025] Video
https://www.reddit.com/r/UkraineWarVideoReport/comments/1ka397n/special_smoking_operation_on_a_russian_ammunition/?rdt=52085


15,281 posted on 04/29/2025 6:09:52 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15276 | View Replies]

To: AdmSmith
Ukrainian ground crew and their AN-196 Lyutyy long-range attack drone, ready to launch on a deep strike into Russian territory.

https://x.com/Osinttechnical/status/1917030491565527289


15,282 posted on 04/29/2025 6:10:13 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15277 | View Replies]

The woman in the top video lives in Moscow. This survey was recorded on Easter, April 20. The desire of the Russians to continue the war in Ukraine does not change even a day like the resurrection of Jesus Christ. Video w/translation

https://www.reddit.com/r/UkraineWarVideoReport/comments/1k9wsts/the_woman_in_the_top_video_lives_in_moscow_this/


15,283 posted on 04/29/2025 6:11:42 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15281 | View Replies]

To: PIF

Anton Gerashchenko@Gerashchenko_en
Attention, Europe!

Nuclear threats from Russian propagandist Solovyev.

He believes it is inexpedient to hit the US as there will be a powerful response, but hitting Europe is just the right thing to do.
https://x.com/Gerashchenko_en/status/1916877140584178125

[ I guess he never heard on NATO Article 5 ]


15,284 posted on 04/29/2025 6:14:35 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15283 | View Replies]

To: PIF
🇺🇦 👀 Ukraine has received a request for the export of its domestic Delta combat information system from one of its NATO partner countries, - Militarnyi

❗️The request for export: Delta digital situational awareness system, which the military uses for communication, informing adjacent units and senior command, as well as coordinating actions on the front line.

https://x.com/Maks_NAFO_FELLA/status/1917194464445239466


15,285 posted on 04/29/2025 6:20:02 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15284 | View Replies]

To: FtrPilot
The Muscovy Welfare Fund is in danger

The adviser to the head of the Central Bank recalled that since 2024 the cut-off price has been set at $60 per barrel of Urals oil, but now its actual price is lower. “The Finance Ministry is selling funds accumulated in the National Welfare Fund in order to cover the shortfall in oil and gas revenues due to the decline in oil prices. This situation cannot last long: if oil prices really remain below $60 for a long time, then the NWF will sooner or later simply run out - there are not many liquid assets there,” he explained.

In this regard, Kirill Tremasov considered the prospect of reducing the oil cutoff price possible. This, in his opinion, will lead to a reduction in budget expenditures, and therefore, budget consolidation. The head of the Central Bank Elvira Nabiullina earlier supported the initiative to reduce the cut-off price of oil. According to her, this will increase the long-term stability of the budget and will become an additional disinflationary factor.

https://www.kommersant.ru/doc/7693406

15,286 posted on 04/29/2025 6:54:18 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15285 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russians Lost Air Superiority. Biggest Swedish Military Aid Package Changes The Game! ]

Today [ Apr 28, 8 pm ], there is an interesting update concerning the defense of Ukrainian skies. Here, the Ukrainian air defense got one of the biggest boosts as reports emerged that a new powerful flying radar from Sweden had probably already arrived in Ukraine. This system will help the Ukrainian air defenses not only in their offensive operations but will also significantly support their ability to defend the Ukrainian rear from constant Russian missile and drone attacks.

Sweden has pledged to deliver two ASC-890 airborne warning and control system planes to Ukraine as part of its largest military aid package to date, valued at approximately 1.16 billion euros. Sweden’s decision marks a significant enhancement in Ukraine’s air defense capabilities.

These aircraft, equipped with advanced Erieye radar systems, are designed to provide long-range surveillance and target identification. While official confirmation is pending, there are reports that a calibration aircraft was flying over western Ukraine, which might indicate Ukrainians are making final preparations, recalibrating and fine-tuning ground-based radars for the arrival of the new Swedish planes.

The ASC-890, based on the Saab 340 airframe, is an airborne early warning and control aircraft. It features the Erieye radar, a fixed, active electronically scanned array mounted atop the fuselage. This radar system offers a detection range of up to 450 km and can track multiple targets simultaneously, including aircraft, missiles, and drones.

By operating at high altitudes of 6,000 meters, the ASC-890 can monitor vast areas, providing real-time data to command centers and enhancing situational awareness. Essentially, aircraft like the ASC-890 serve as flying radar stations and command centers, coordinating air and ground operations effectively, with its compact size and reliability making it ideal for rapid deployment.

In the context of Ukraine’s current defense infrastructure, the ASC-890 represents a substantial upgrade. Ukraine’s existing radar systems are primarily ground-based, and even though some of them have a range of around 350 to 400 km, their immobility limits their range and makes them vulnerable to terrain obstructions. The ASC 890’s airborne platform overcomes these limitations, offering a broader and more flexible surveillance capability. This enhancement is crucial for the early detection of incoming threats, more accurate tracking of them, and a better response time that would allow Ukrainian air defense to intercept air threats more successfully.

The integration of the ASC-890 is particularly significant in light of Ukraine’s acquisition of Western fighter jets, notably the F-16s. After the manufacturer, SAAB, made some updates to improve the interoperability between the 2 systems, the ASC-890 can now provide these aircraft with comprehensive situational awareness, guiding them to targets and alerting them to potential threats.

As a result, these awacs will significantly improve the engagement range of the F-16s, allowing them to use their modern air-to-air missiles at their maximum ranges, as well as providing a significant improvement to the limited radar detection range of the F-16.

This synergy enhances the operational effectiveness of fighter jets, enabling more precise and coordinated missions. Additionally, the ASC-890’s data can even support Soviet-era Ukrainian fighter jets, extending their operational capabilities despite technological disparities. Sharing real-time radar data and threat information with ground-based command centers, Ukrainians can then relay targeting and situational awareness updates to the pilots via secure radio or datalink.

This allows older aircraft, despite lacking modern onboard radars, to operate more effectively by flying with external guidance and warning support.

Contrastingly, Russia’s equivalent platform, the Beriev A-50, has faced significant challenges. Since early 2024, Ukraine has successfully targeted and destroyed at least two A-50 aircraft, utilizing systems like the Patriot missile defense. These losses have compelled Russia to operate its remaining A-50 fleet even further from the front lines, diminishing its surveillance effectiveness over Ukrainian territory. [ Now grounded ]

The reduced presence of A-50s near Ukraine hampers Russia’s ability to conduct continuous airborne surveillance and coordinate air operations effectively.

Overall, the arrival of Sweden’s ASC-890 aircraft is a strategic boon for Ukraine, especially amid uncertainties regarding continued American intelligence support. These aircraft not only bolster Ukraine’s air defense and surveillance capabilities but also ensure greater autonomy in operational planning and threat response.

As the war continues the ASC890 will fill in gaps as a critical asset in safeguarding Ukrainian airspace and enhancing the effectiveness of its aerial operations.

https://www.youtube.com/watch?v=uWyhob-p3wU


15,287 posted on 04/29/2025 7:19:29 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15286 | View Replies]

To: FtrPilot; PIF; AdmSmith; slow
🍈


15,288 posted on 04/29/2025 8:08:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15285 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-50 ... 14,101-14,15014,151-14,20014,201-14,250 ... 15,251-15,288 next last
To: JonPreston

Dear Mr. Musk,
@elonmusk

14,151 posted on 03/30/2025 5:41:29 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14149 | View Replies | Report Abuse]

To: All

14,152 posted on 03/30/2025 5:41:48 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14150 | View Replies | Report Abuse]

To: FtrPilot
(LAST)
14,153 posted on 03/30/2025 5:41:50 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14150 | View Replies | Report Abuse]

To: blitz128

lol quite proud of my high school diploma, almost 40 years of military service, and running a company worth several million.

Appreciate the recognition, aside from posting memes and insulting others who disagree with you, 🍈 what have you accomplished with that “superior intellect”🤔

14,154 posted on 03/30/2025 5:42:28 AM PDT by blitz128
[ Post Reply | Private Reply | To 14138 | View Replies | Report Abuse]

To: FtrPilot

But, but, but look at the GDP chart, all is going swimmingly 😎

14,155 posted on 03/30/2025 5:43:54 AM PDT by blitz128
[ Post Reply | Private Reply | To 14150 | View Replies | Report Abuse]

To: PIF
59th Brigade repels Russian attacks on unarmored vehicles.

https://x.com/bayraktar_1love/status/1906299365074854118


14,156 posted on 03/30/2025 5:44:34 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14152 | View Replies | Report Abuse]

To: blitz128
quite proud of my high school diploma and running a company worth several million.

🍈


14,157 posted on 03/30/2025 5:48:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14154 | View Replies | Report Abuse]

To: PIF
Interceptions of Russian drones by a drone armed with shotguns.

https://x.com/bayraktar_1love/status/1906284737624257012

Amazing video at the link above!

14,158 posted on 03/30/2025 5:48:30 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14156 | View Replies | Report Abuse]

To: PIF
Unequal Battle T-90M Breakthrough vs Barbed Wire.

The tank got tangled in a wire fence, dragged it a dozen meters and stopped. And it looks like overnight, ground drones quickly deployed new barbed wire around the tank to cover a potentially vulnerable spot.

https://x.com/bayraktar_1love/status/1906281541174485492


14,159 posted on 03/30/2025 5:52:41 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14158 | View Replies | Report Abuse]

To: BeauBo
🔥 The 🇷🇺 Russian invader decided to hide in a barn. But FPV drone of the 🇺🇦 79th Air Assault Brigade found him 😊

https://x.com/GloOouD/status/1906000072036212992


14,160 posted on 03/30/2025 6:13:58 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14159 | View Replies | Report Abuse]

To: gleeaikin
‼️👇 20 Moscow boys, including a platoon commander, surrendered to the 12th special forces brigade "Azov" in the Toretsk area.

https://x.com/PStyle0ne1/status/1906067676688224575


14,161 posted on 03/30/2025 6:20:02 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14160 | View Replies | Report Abuse]

To: blitz128

🍈 even if that were true and it is not, that would be something to be proud of, still waiting on your “expert” resume 😂🤔

14,162 posted on 03/30/2025 6:31:46 AM PDT by blitz128
[ Post Reply | Private Reply | To 14154 | View Replies | Report Abuse]

To: FtrPilot

The T-90 breakdown Tank pride of Russia, what t-14 doink

Sad just more GDP down the drain😂

14,163 posted on 03/30/2025 6:33:51 AM PDT by blitz128
[ Post Reply | Private Reply | To 14159 | View Replies | Report Abuse]

To: FtrPilot

Fantastic, so much GDP falling out of the sky😂

14,164 posted on 03/30/2025 6:35:21 AM PDT by blitz128
[ Post Reply | Private Reply | To 14158 | View Replies | Report Abuse]

To: blitz128
More Russian fighters are complaining: they’re treated as "cannon fodder" in a hopeless situation.

Families appealed to authorities but got only empty responses.

The fighters also report beatings and threats at their unit.

https://x.com/wartranslated/status/1906340636493578750


14,165 posted on 03/30/2025 6:44:17 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14164 | View Replies | Report Abuse]

🍈

😂


14,166 posted on 03/30/2025 6:48:47 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14162 | View Replies | Report Abuse]

To: PIF
In an attempt to protect their equipment from Ukrainian drone attacks, Russians are upgrading their anti-drone "grill" technology, as the thin netting proved ineffective. So, they decided to shield the turret with steel cables.

https://x.com/wartranslated/status/1906246234639139042

This might prevent the classic turret toss.

However, if an FPV drone hits the tracks, it will surely achieve an M-kill.

The tank crew would survive and become part of the meat-wave.


14,167 posted on 03/30/2025 6:51:25 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14165 | View Replies | Report Abuse]

To: blitz128

14,168 posted on 03/30/2025 6:53:02 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14163 | View Replies | Report Abuse]

To: FtrPilot

🎶🇺🇦 Today marks the 11th anniversary of the legendary song “Putin-Khuilo” by Kharkiv fans of Metalist football club, which they performed at a joint march with Shakhtar Donetsk ultras.

https://bsky.app/profile/maks23.bsky.social/post/3lllbql5j3s2q

24 sec video

14,169 posted on 03/30/2025 6:55:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14165 | View Replies | Report Abuse]

https://en.wikipedia.org/wiki/Putin_khuylo%21

14,170 posted on 03/30/2025 6:56:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14169 | View Replies | Report Abuse]

To: Widget Jr
"Or it could be F-16s SEAD missions."

I don't know if the Ukrainian F-16s are equipped with the AN/ASQ-213 HARM targeting system.

However, with SDBs and JDAM-ERs, the F-16s can accurately attack targets without entering the engagement zone of ruzzian short range SAMs.

F-16 SEAD missions are not required.

14,171 posted on 03/30/2025 6:58:45 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14117 | View Replies | Report Abuse]

To: PIF
🔥 Incredible work of the 🇺🇦 Ukrainian 59th Assault UAV Brigade on destruction of 🇷🇺 Russian invaders in the Pokrovsk direction.

https://x.com/GloOouD/status/1906334601213051211

Pokrovsk on Google Maps

14,172 posted on 03/30/2025 7:09:05 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14171 | View Replies | Report Abuse]

To: PIF

14,173 posted on 03/30/2025 7:13:19 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14172 | View Replies | Report Abuse]

To: AdmSmith
⚡️ 🇪🇺 European nations plan to deploy air and naval forces to Ukraine – The Washington Post.

A military assessment team will soon be sent to determine the necessary force levels.

https://x.com/NOELreports/status/1906338919353815481


14,174 posted on 03/30/2025 7:19:14 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14173 | View Replies | Report Abuse]

To: blitz128
Russian attack with large numbers of civilian vehicles and motorcycles on the Siversk front.

https://x.com/bayraktar_1love/status/1906077303102456067


14,175 posted on 03/30/2025 7:28:02 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14174 | View Replies | Report Abuse]

To: PIF
🔥👀 Sudzha gas metering station

https://x.com/Maks_NAFO_FELLA/status/1906343201306230824


14,176 posted on 03/30/2025 7:32:17 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14175 | View Replies | Report Abuse]

To: marcusmaximus; All
Trump called me to say he’s furious with Putin and ready to impose additional tariffs on Russian oil, NBC journalist reports.

He said that if Russia doesn’t agree to stop the war in Ukraine, and if he thinks they’re to blame, he’ll slap 25% tariffs on Russian oil anytime.

He plans to talk to Putin this week.

Trump added he was outraged when Putin questioned Zelensky’s legitimacy and started talking about new leadership in Ukraine.

https://x.com/wartranslated/status/1906351032809992500

pootin fanbois hardest hit.

14,177 posted on 03/30/2025 7:36:17 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14176 | View Replies | Report Abuse]

To: AdmSmith

“The Central Bank has begun preparing for a “very severe crisis.””

Things are going to come to a head this year. Russia needs a deal, despite themselves.

14,178 posted on 03/30/2025 7:38:09 AM PDT by BeauBo
[ Post Reply | Private Reply | To 14131 | View Replies | Report Abuse]

To: FtrPilot

(Trump) “said that if Russia doesn’t agree to stop the war in Ukraine, and if he thinks they’re to blame, he’ll slap 25% tariffs on Russian oil anytime.”

Mic drop.

That is the bottom line. Trump holds the trump card, to kick the legs out from under the Russian economy, anytime he chooses. Add a few hundred cruise missiles to Ukraine for Russian oil infrastructure, and prepare the popcorn.

14,179 posted on 03/30/2025 7:45:54 AM PDT by BeauBo
[ Post Reply | Private Reply | To 14177 | View Replies | Report Abuse]

To: FtrPilot

Correction:

Actually, American tariffs on Russian oil won’t do much, but secondary sanctions on third country buyers is the trump card.

14,180 posted on 03/30/2025 7:47:58 AM PDT by BeauBo
[ Post Reply | Private Reply | To 14177 | View Replies | Report Abuse]

To: BeauBo
"Actually, American tariffs on Russian oil won’t do much, but secondary sanctions on third country buyers is the trump card."

I believe "secondary sanctions" are what President Trump is referring to.

Any country buying ruzzian oil will face 25% tariffs on all trade with U.S.

14,181 posted on 03/30/2025 7:53:28 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14180 | View Replies | Report Abuse]

To: BeauBo; marcusmaximus; All
👀 🇺🇸 "If Russia does not agree to end the war, I will introduce secondary tarrifs on all Russian oil. That is, if you buy Russian oil, you cannot do business with the US," — Trump

❗️"Tarrifs on Russia will be introduced within a month if there is no ceasefire agreement," he said.

https://x.com/SavchenkoReview/status/1906355399978037516


14,182 posted on 03/30/2025 8:02:40 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14181 | View Replies | Report Abuse]

To: FtrPilot
"secondary tarrifs on all Russian oil. That is, if you buy Russian oil, you cannot do business with the US"


14,183 posted on 03/30/2025 8:21:13 AM PDT by BeauBo
[ Post Reply | Private Reply | To 14182 | View Replies | Report Abuse]

To: FtrPilot; AdmSmith; PIF

“Tarrifs on Russia (secondary sanctions on buyers of Russian oil) will be introduced within a month if there is no ceasefire agreement”

Ceasefire by Easter looking likely...

14,184 posted on 03/30/2025 8:24:19 AM PDT by BeauBo
[ Post Reply | Private Reply | To 14182 | View Replies | Report Abuse]

To: FtrPilot

A couple of rolls at most of concertina wire cost what? a few hundred dollars and the T-90M cost a few million? Not possible; the hardened Russia genius has proclaimed the T-690M is the best tank in the world. Invincible!

14,185 posted on 03/30/2025 8:42:31 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14159 | View Replies | Report Abuse]

To: FtrPilot

The tank crew would survive and become part of the meat-wave.


Assuming the tank driver can even see where he’s going in the first place.

14,186 posted on 03/30/2025 8:45:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14167 | View Replies | Report Abuse]

To: FtrPilot

Oh noes, not another one!

14,187 posted on 03/30/2025 8:47:24 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14173 | View Replies | Report Abuse]

To: FtrPilot; ETCM; PIF

US to but Finnish icebreakers - much faster and cheaper than building them here (2 years from contract signing).

And get Greenland too.

Kyiv Independent:

Finnish President Alexander Stubb spoke with U.S. President Donald Trump about the war in Ukraine and other policy matters during a visit to Trump’s Mar-a-Lago residence in Florida on March 29.

Stubb’s visit was “unofficial,” according to a press release from the Finnish government. It involved breakfast, lunch, and a round of golf...

...Following his meeting with Stubb, Trump announced that the U.S. would purchase Finnish icebreaker vessels.

“President Stubb and I look forward to strengthening the partnership between the United States and Finland,” Trump wrote in a post on the social media platform Truth Social.

“That includes the purchase and development of a large number of badly needed icebreakers for the U.S.”

The icebreakers are critical to Trump’s plans to expand U.S. power over the Arctic. The purchase announcement comes a day after U.S. Vice President JD Vance made a controversial visit to Greenland, an autonomous Danish territory Trump has threatened to annex.

Trump reiterated those ambitions on March 29 in an interview with NBC News.

“We’ll get Greenland. Yeah, 100%,” he said.

Trump said there was a “good possibility that we could do it without military force,” but refused to rule out a military takeover.

“I don’t take anything off the table,” he said.”

14,188 posted on 03/30/2025 8:49:22 AM PDT by BeauBo

15,289 posted on 04/29/2025 8:13:46 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15288 | View Replies]

To: Jim Robinson

Jon Preston, an unfailing supporter of KGB Colonel Putin and Russian aggression, has been overtly spamming this thread covering the war in Ukraine repeatedly posting the same memes over and over, for months.

Stalking, spamming, trolling and insulting every single day, to shout down and suppress the speech of anyone who opposes Russian conquest and war crimes.

Now his new tactic is simply to copy apparently random large blocks of posts from a year ago, simply to clutter and sabotage the forum.

His posting of the most outlandish un-American Russian propaganda is one thing, but his enduring pattern of overt harassment violates the essential nature of Free Republic as an honest discussion forum.

Several people have been driven away from Free Republic, due to his repetitive personal stalking and harassment - something in which he has taken great pride. His mission is clearly to purge the forum of any opinion in opposition to the KGB/FSB party line on Russia’s war of conquest in Ukraine; by any means, no matter how uncivil, unfair, dishonest or reprehensible.


15,290 posted on 04/29/2025 9:42:30 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15271 | View Replies]

To: BeauBo; Jim Robinson

Seconding BeauBo’s post: I have asked the mods on 2 occasions to tell JonPreston to stop posting 30-50 aggregated posts from the past as it make the thread confusing and generally unuseful and unreadable ( which is likely his purpose ).

Please tell him to stop the aggregated posts.

Thank you in advance,
PIF


15,291 posted on 04/29/2025 9:58:50 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15290 | View Replies]

[ Post Reply | Private Reply | To 14803 | View Replies | Report Abuse]

To: AdmSmith

“ Yes, Muscovy Central Bank: If the SVO does not end by the summer, or at the latest in June, a terrible, very severe crisis will hit the Russian economy.”

I guess like Christmas the orthodox Russians have a different start date for summer

Summer starts jun 20th 🤔

And 🍈 why is the central bank talking about Moscow international airport(SVO)😂

14,806 posted on 04/12/2025 6:47:42 AM PDT by blitz128

15,292 posted on 04/29/2025 12:38:44 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14801 | View Replies]

To: PIF

Sounds like Russia is trying to blow some smoke, to cover themselves for not heeding president Trump’s urging for a 30 day ceasefire and direct negotiations to end the war by today (Trump’s 100th day in office). Ukraine accepted 50 days ago.

Kyiv Independent reports:

“Russian President Vladimir Putin’s proposal for a ceasefire on Victory Day is the beginning of direct talks with Kyiv, Russian Foreign Minister Sergey Lavrov said on April 29 during a press briefing.

“Our proposal, which President Putin voiced, is the start of direct negotiations, without preconditions. In this situation, a ceasefire (for 30 days) is seen as a precondition,” Lavrov said.”

Translation: No to Trump’s 30 day ceasefire, and an assertion that a single unilateral statement from the Kremlin should be taken for counting as Russia participating in direct negotiations with Ukraine to end the war (for the purpose of Russia avoiding the banking and secondary sanctions that Trump has threatened for not complying).

Bottom Line: Russia is running out their grace period with President Trump for an easy way out of the mess the have made.


15,293 posted on 04/29/2025 1:07:20 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15291 | View Replies]

To: BeauBo

Just stalling until more forces brought up and maybe some of the T-90M tanks transferred from storage near Finland border.


15,294 posted on 04/29/2025 3:39:42 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15293 | View Replies]

Free Republic
Browse · Search
Pings · MailBloggers & Personal
Topics · Post Article

Skip to comments.Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans; Click to Add Topic
KEYWORDS: 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas; Click to Add Keyword
[ Report Abuse | Bookmark ]

Navigation: use the links below to view more comments.
first 1-5051-100101-150151-200 ... 15,251-15,293 next last
Ukrainian Tank losses Running Total: 748

Ukrainian Artillery losses Running Total: 475

RuZZian Tank losses Running Total: 2754
February 2024 – 76
January 2024 – 98
December 2023 – 74
November 2023 – 67
October 2023 – 108
September 2023 – 57
August 2023 – 86
July 2023 – 113
June 2023 – 73
May 2023 – 90
April 2023 – 5
March 2023 - 127
February 2023 – 118
January 2023 – 61
December 2022 – 76
November 2022 – 105
October 2022 – 212
September 2022 - 217
August 2022 – 74
July 2022 – 108
June 2022 – 67
May 2022 – 148
April 2022 – 243
Feb 24 - March 2022 – 350

RuZZian Artillery losses Running Total: 1025
February 2024 - 22
January 2024 - 32
December 2023 - 33
November 2023 - 25
October 2023 - 77
September 2023 - 48
August 2023 - 67
July 2023 - 56
June 2023 - 47
May 2023 - 43
April 2023 - 24
March 2023 - 37
February 2023 – 41
January 2023 – 31
December 2022 – 19
November 2022 – 55
October 2022 – 64
September 2022 - 73
August 2022 – 21
July 2022 – 21
June 2022 – 18
May 2022 – 20
April 2022 – 52
Feb 24 - March 2022 – 110


1 posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | View Replies | Report Abuse]

To: FtrPilot; PIF; BeauBo; blitz128; Magnum44

Who could of believed 2 years ago that RuZZia couldn’t conquer Ukraine?

2 years later, Ukraine is destroying RuZZia’s Black Sea Fleet, Air Force and Army.

All while liberating half of the land RuZZia seized at the beginning of the war.

What a wild 2 years.

2 posted on 02/24/2024 5:59:19 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: PIF

Avdiivka was a costly ‘win’ for RuZZia. With ‘wins’ like that, they will lose the war.

“#Avdiivka offensive equipment loss numbers as of 23 February 2024. In summary: 690 RU losses vs. 75 UA losses As Russia has now successfully captured the city of Avdiivka, future updates will be to tally newly discovered losses. Losses proven to have occured after the city was captured will also be culled in the future. Spreadsheet showing the losses in detail:”

https://twitter.com/naalsio26/status/1761206101108724109

3 posted on 02/24/2024 5:59:38 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: PIF

“Battle of #Krynky equipment loss numbers as of 23 February 2024. In summary: 47 UA losses vs. 222 RU losses Spreadsheet showing the losses in detail:”

https://twitter.com/naalsio26/status/1761217261384458502

4 posted on 02/24/2024 5:59:50 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 3 | View Replies | Report Abuse]

To: PIF

The Memories

“On 24 February 2022, a Russian Black Sea flagship “Moskva” approached Zmeiniy Island and offered the garrison to lay down weapons and surrender. A Ukrainian border guard Roman Valentinovich Hrybov responded in a rude form, telling the warship to go **** itself. Cruiser “Moskva” was later sunk on 14 April, and the island returned to full Ukrainian control by 30 June. Although captured in the attack, on his release, Hrybov was awarded a medal for his actions at the end of March”

https://twitter.com/wartranslated/status/1761348038075805703

5 posted on 02/24/2024 6:00:06 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 4 | View Replies | Report Abuse]

To: PIF

“The 47th Mechanized Brigade destroyed a Russian TOS-1A Solntsepek in the Avdiivka direction.”

https://twitter.com/NOELreports/status/1761349991019274572

6 posted on 02/24/2024 6:00:18 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 5 | View Replies | Report Abuse]

To: PIF

“Condor unit from the 1st Separate Presidential Brigade destroyed a Russian BMP with an FPV drone.”

https://twitter.com/NOELreports/status/1761341482298999080

7 posted on 02/24/2024 6:00:38 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 6 | View Replies | Report Abuse]

To: PIF

“The UK will spend £245 million throughout the next year to procure and invigorate supply chains to produce urgently needed artillery ammunition for Ukraine.”

https://twitter.com/NOELreports/status/1761315922361385314

8 posted on 02/24/2024 6:00:55 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 7 | View Replies | Report Abuse]

To: PIF

„Ukraine attacked the Novolipetsk Steel Company Metallurgic Plant in Lipetsk overnight.”

https://twitter.com/NOELreports/status/1761279812545700235

9 posted on 02/24/2024 6:01:08 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 8 | View Replies | Report Abuse]

To: PIF

“The Ukrainian 81st Airmobile Brigade destroys Russian invaders in Bilohorivka direction, Luhansk region with drone dropped munitions.”

https://twitter.com/GloOouD/status/1761388098980635123

10 posted on 02/24/2024 6:01:31 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 9 | View Replies | Report Abuse]

To: SpeedyInTexas

Zombie thread arises!

11 posted on 02/24/2024 6:09:25 AM PST by dynoman (Objectivity is the essence of intelligence. - Marilyn vos Savant)
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: PIF; All

“Two years of war for Russia has plunged the country ever deeper into darkness”

“Two years ago, when Russia launched its full-scale invasion of Ukraine, I was among the many long-time observers of the Kremlin who got it wrong.

Few could fathom why Vladimir Putin, Russia’s calculating leader, would embark on such a risky military adventure, especially when the mere threat of a Russian invasion was already yielding results.

In June the previous year, as Russian forces massed near Ukraine, US President Joe Biden met Putin at a superpower-style summit, describing the US and Russia as “two great powers” elevating the Russian leader after previous US administrations had sought to downplay Russia’s influence.

In the days before the 2022 invasion, Washington offered a “pragmatic evaluation” of Moscow’s security concerns, signalling openness to compromise.”

https://www.cnn.com/2024/02/24/europe/ukraine-war-russia-two-years-analysis-intl/index.html

12 posted on 02/24/2024 6:11:05 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 11 | View Replies | Report Abuse]

To: SpeedyInTexas

You are delusional. Did you add the 2 Abrams taken out yesterday? The Ukes are winning?! Ridiculous. What the heck, go for it. You can’t look any more absurd than you already do. The Ukes are winning.

https://youtu.be/J-ifjIAoleI?si=aDrFdW1LiEP60KY7

13 posted on 02/24/2024 6:12:41 AM PST by hardspunned (Former DC GOP globalist stooge)
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: SpeedyInTexas
Pierwszy alarm przeciwlotniczy w Kijowie rano 24 lutego 2022 roku.

Translation:

First air raid alert in Kyiv on the morning of February 24, 2022.

https://twitter.com/Artur_Micek/status/1761286893172412461


14 posted on 02/24/2024 6:13:20 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12 | View Replies | Report Abuse]

To: PIF; All

“Russia’s Brutal War Calculus”

“Two years of war have remade Russia.

Isolated from the West, it is now more dependent on China. Political repression is reminiscent of the grim days of the Soviet Union.

But Russia is not the economic shambles many in the West predicted when they imposed punishing sanctions over the invasion of Ukraine. Many Russians are pulling down their highest incomes in years.

Russian society has been refashioned in ways that have devastated some and lifted others. While government critics languish in jail and young men die in trenches at the front, other Russians — especially those willing to spout the official line — are feeling more optimistic than ever.

Here is a look at how Russia at war has changed — suffering enormous costs by some metrics but faring better than expected by others.”

https://archive.ph/cR4Xn

15 posted on 02/24/2024 6:16:20 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 13 | View Replies | Report Abuse]

To: SpeedyInTexas; All
Ранок 24.02.22 десант РФ. Всi cдохли як собаки за декiлька годин.

Translation:

The morning of February 24, 2022, the landing force of the Russian Federation. All died...

https://twitter.com/Viaches50993743/status/1761245362696712249


16 posted on 02/24/2024 6:18:12 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12 | View Replies | Report Abuse]

To: PIF; All

“Abducted Ukrainian shares story of survival in Austin”

“At just 16 years old, Ivan Matkosvsyi has endured two years of war.

He fled on foot from his war-torn hometown of Mariupol — one of the cities most ravaged by the Russian invasion — after a month often spent in a bomb shelter. But on that long walk to safety, he was taken by Russian troops.

“I came across the Russian checkpoint, and they forced me to take almost all my clothes off,” Ivan recounted in Ukrainian. “I didn’t want to separate from my older brother. We decided to just escape. But they caught us and started threatening us with weapons. Thankfully, my brother was released and he was able to go to Ukraine, but I was sent to Donetsk.””

https://www.kxan.com/news/abducted-ukrainian-shares-story-of-survival-in-austin/

17 posted on 02/24/2024 6:21:48 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 16 | View Replies | Report Abuse]

To: PIF; All

1/3 Gone. Gone With the Wind.

“Ukraine Has No Navy. But It’s Hammering Russia In The Black Sea.”

“The grainy black-and-white video showed what appeared to be a fast-moving speedboat bobbing on the nighttime waves, swerving back and forth as it approaches a much larger warship. The ship then explodes spectacularly, and the nearly 3-minute video ends with a vessel seen rolling onto its port side just before it sinks.

The speedboat was in fact a Ukrainian-designed unmanned maritime drone packed with explosives, known as the MAGURA-V. The warship purportedly was the Tsezar Kunikov, one of just a handful of heavy landing ships in Russia’s Black Sea Fleet. It sank off the southern coast of Crimea, the Ukrainian peninsula Russia seized 10 years ago. The fate of the ship’s crew, estimated at around 70, is unclear.

One day after, the admiral in charge of the Black Sea Fleet was reportedly stripped of his command.

The Tsezar Kunikov is one of nearly two dozen Russian warships that Ukraine has seriously damaged or outright sunk since Russia began its full-scale invasion on February 24, 2022.

Prior to its sinking, Oryx, a Dutch open-source website known for verified tallies of Russian and Ukrainian equipment losses, put the figure at 21 warships and one submarine. Ukraine’s general staff has a slightly higher count: 24 Russian ships and one submarine.

That works out to approximately a third of the entire fleet, which numbers around 74. Those figures do not include smaller craft such as shallow-draft coastal patrol boats or auxiliary vessels.”

https://www.rferl.org/a/ukraine-navy-black-sea-russia/32826343.html

18 posted on 02/24/2024 6:23:34 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 17 | View Replies | Report Abuse]

To: Allegra; AndyJackson; ANKE69; bimboeruption; dforest; doorgunner69; fireman15; MoochPooch; ...

ZEEPER FOLLIES PINGLIST!

(((PING!)))

... to be added to the best Zeeper-provided entertainment since Paul Shanklin parodies, ping me bro.

19 posted on 02/24/2024 6:25:18 AM PST by aMorePerfectUnion
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: PIF; All

Droned

https://twitter.com/antiputler_news/status/1761379357367427466

20 posted on 02/24/2024 6:28:30 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 19 | View Replies | Report Abuse]

To: aMorePerfectUnion

ZZpedy in TexaZZ trollZZ himself with hiZZ own ZZeeProp.

21 posted on 02/24/2024 6:37:50 AM PST by AndyJackson
[ Post Reply | Private Reply | To 19 | View Replies | Report Abuse]

To: SpeedyInTexas
The largest metallurgic plant in Russia was attacked last night by unidentified aerial vehicles.

The plant's produce has strategic value. Metal and alloys produced there are used for missiles, among other things.

According to some sources, drones hit the machines designed for primary cooling of raw coke oven gas. The strike on these facilities could lead to a shutdown of the entire production process of the metallurgical plant for a long time.

https://twitter.com/wartranslated/status/1761314832853107067


22 posted on 02/24/2024 6:38:03 AM PST by FtrPilot
[ Post Reply | Private Reply | To 20 | View Replies | Report Abuse]

To: SpeedyInTexas
Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)

What an unbelievable waste of Russian (and Ukrainian) lives all because of one dictatorial psychopath-Putin

KIU ✪ Russian Officers killed in Ukraine 🇨🇿🇺🇦 @KilledInUkraine

In the two years of Russia’s criminal invasion, the Armed Forces of Ukraine have eliminated at least 3 627 Russian officers. Confirmation for each name from a Russian source is available in our dataset (obituary, grave, memorial plaque, etc.) see @KilledInUkraine


23 posted on 02/24/2024 6:38:42 AM PST by tlozo ( Better to Die on Your Feet th>>an Live on Your Knees )
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: SpeedyInTexas

I typically don’t post on propaganda threads such as this, but that “ZZ” thing in Russia is just childish and annoying.

Makes a person wonder just what is the motivation behind the creator of thread doing multiple postings, machine style, one right after another, on his own thread?

Could it be belief in cause? Or possibly a little financial motivation? I don’t know the answer, but what’s obvious is all this Uke war propaganda from various persons is unlike the propaganda from any other era, conflict or war.

24 posted on 02/24/2024 6:39:11 AM PST by redfreedom (Joseph Stalin: "It does not mater how anyone votes, how votes are counted is what matters.")
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: AndyJackson

Truth!

25 posted on 02/24/2024 6:41:02 AM PST by aMorePerfectUnion
[ Post Reply | Private Reply | To 21 | View Replies | Report Abuse]

To: SpeedyInTexas
💥 The $300 million Russian A-50 AWACS shot down over Azov Sea crashed on the coast. This leaves Russia with just one serviceable A-50 aircraft.

https://twitter.com/igorsushko/status/1761093367474307184

Yes...the latest ruzzian suicide drone took out a Ukrainian S-200 missile.

This leaves Russia with just one serviceable A-50 aircraft.

...one serviceable A-50...

26 posted on 02/24/2024 6:50:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 2 | View Replies | Report Abuse]

To: redfreedom
Could it be belief in cause? Or possibly a little financial motivation? I don’t know the answer.

It probably requires a professonional evaluation running through the gamut of maladies and afflications in the Diagnostic and Statistical Manual of Mental Disorders.

27 posted on 02/24/2024 6:52:23 AM PST by AndyJackson
[ Post Reply | Private Reply | To 24 | View Replies | Report Abuse]

Comment #28 Removed by Moderator

To: redfreedom

“Could it be belief in cause? “

I don’t know.

Maybe a little dictator has brutally invaded a European country???

29 posted on 02/24/2024 6:56:46 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 24 | View Replies | Report Abuse]

To: FtrPilot

9 were built, 1 was damaged (repaired?), 2 shot down. Leaves 6 A-50 and A-50Us

30 posted on 02/24/2024 6:58:55 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 26 | View Replies | Report Abuse]

To: FtrPilot

"Just think if you had been quicker about wanting to go for a ride, you could have been piloting this new A-50U model drone, with all new undefeatable electronics!"
31 posted on 02/24/2024 7:03:53 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 26 | View Replies | Report Abuse]

To: PIF; All

Someone once said:

“Until in God’s good time, the New World with all its power and might steps forth to the rescue and the liberation of the old”

32 posted on 02/24/2024 7:06:48 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 31 | View Replies | Report Abuse]

To: PIF
I believe they are saying that 5 of the 6 remaining A-50s are not flyable (Operational Ready (OR)) or are not Mission Ready (MR).

Not MR could be caused by radar equipment not functional. The aircraft can fly but cannot perform its mission.

33 posted on 02/24/2024 7:08:40 AM PST by FtrPilot
[ Post Reply | Private Reply | To 30 | View Replies | Report Abuse]

To: PIF; All

Droned

https://twitter.com/Heroiam_Slava/status/1761345322339483732

34 posted on 02/24/2024 7:10:19 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 32 | View Replies | Report Abuse]

To: redfreedom
Could it be belief in cause? Or possibly a little financial motivation? I don’t know the answer, but what’s obvious is all this Uke war propaganda from various persons is unlike the propaganda from any other era, conflict or war.

The owner of this site has politely requested less propaganda from these people.

It’s as if they’re addicted to it. That weird little method they have of posting several rapid-fire propaganda posts one after another is quite bizarre.

35 posted on 02/24/2024 7:55:54 AM PST by Allegra (Less propaganda would be appreciated. )
[ Post Reply | Private Reply | To 24 | View Replies | Report Abuse]

To: SpeedyInTexas
...Cruiser “Moskva” was later sunk on 14 April...

The Memories

36 posted on 02/24/2024 7:56:03 AM PST by FtrPilot
[ Post Reply | Private Reply | To 5 | View Replies | Report Abuse]

To: SpeedyInTexas; All; Firehath; Worldtraveler once upon a time

Just a reminder of speedy’s mental state:

To: Travis McGee
I would rather the world end in nuclear war than yield to Little Pukin.
15 posted on 10/12/2022, 7:02:03 AM by SpeedyInTexas (RuZZia is the enemy of all mankind)
[ Post Reply | Private Reply | To 4 | View Replies]
15 posted on 10/12/2022, 7:02:03 AM by SpeedyInTexas
https://freerepublic.com/focus/f-bloggers/4099982/posts?page=15#15

To: Worldtraveler once upon a time
I stand by that statement. S it up.
55 posted on 11/25/2023, 5:42:24 PM by SpeedyInTexas (RuZZia is the enemy of all mankind) [ Post Reply | Private Reply | To 52 | View Replies]
55 posted on 11/25/2023, 5:42:24 PM by SpeedyInTexas
https://freerepublic.com/focus/bloggers/4199173/posts?page=55#55

To: Firehath
>The pc is so thick here - everywhere
Even the dummy strung around parading flag waving right
Little do they know
Horatio Bonar
In The Everlasting Gospel
Called them butchers
In their “ slaughter house of souls “
This war in the ukraine proves it
Judas goats here too<
Poor people being led to the meat grinder.
Jesus wept.

58 posted on 1/9/2024, 10:32:50 PM by bimboeruption (“Less propaganda would be appreciated.” JimRob 12-2-2023)
[ Post Reply | Private Reply | To 54 | View Replies | Report Abuse]
________________________________________
To: bimboeruption
RuZZian people being led to the meat grinder.
Speedy smiled.

59 posted on 1/9/2024, 10:43:30 PM by SpeedyInTexas (RuZZia is the enemy of all mankind)
[ Post Reply | Private Reply | To 58 | View Replies | Report Abuse]
https://freerepublic.com/focus/bloggers/4208829/posts?page=59#59

37 posted on 02/24/2024 7:57:24 AM PST by bimboeruption (“Less propaganda would be appreciated.” JimRob 12-2-2023)
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: aMorePerfectUnion

Forgot muskovites blaming drunk air defense soldiers and of course the ever popular electrical or smoking accident

38 posted on 02/24/2024 8:11:18 AM PST by blitz128
[ Post Reply | Private Reply | To 19 | View Replies | Report Abuse]

To: SpeedyInTexas; All
The Beavis and Butthead Chapter of the Zelensky Fan Club is back...

image host

39 posted on 02/24/2024 8:21:12 AM PST by bimboeruption (“Less propaganda would be appreciated.” JimRob 12-2-2023)
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: SpeedyInTexas
MAJOR DEVELOPMENTS | Robotyne Armored Assault | Russia Captures Lastochkyne | New Stage

Unstoppable. Russia Captured Three Settlements Near Avdiivka. Russian Advance & Entered Ivanivske.

40 posted on 02/24/2024 8:33:41 AM PST by Kazan
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: dynoman
I have a modest proposal. It's really modest, since GHWB and GWB showed us how you deal with "uppity" dictators. Just assemlbe a coalition of the willing, assemble a mountain of metal in various places in eastern Europe and then at an appropriate point you blow up all of RuZZia's important stuff. Then you invade and send the dictator and his troops packing. And voila, no more dictator and eternal PEACE for all of humanity and you fixed the NATO border problem to boot. For all time.

Well ok, maybe that peace thing didn't work out so well the last 2 dozen times we did this, but we've worked out the bugs, brought in DEI and this time it will go according to plan.

Oh, don't worry about those nuke things. That's why we have a detterent - to ensure that he will be vapor in the atmosphere if he so much as thinks about it. The Ruzzians won't obliterate the west. Their stuff doens't work. Just look at their abysmal failure in Ukraine. Open your eyes. Look!

41 posted on 02/24/2024 9:15:37 AM PST by AndyJackson
[ Post Reply | Private Reply | To 11 | View Replies | Report Abuse]

To: SpeedyInTexas; All

Ambulances in Sevastopol rushing to military hospital. Partisans cryptic for now.

42 posted on 02/24/2024 9:56:12 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 34 | View Replies | Report Abuse]

To: marcusmaximus
There are videos on X showing the ambulance arrivals.

No information on what happened.

43 posted on 02/24/2024 10:07:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 42 | View Replies | Report Abuse]

To: PIF; All

MASSIVE they say?

“It is reported that 🇺🇦Himars attacked the restaurant “Arkadia” in temporarily occupied Donetsk. According to reports, the 🇷🇺Russian military/collaborators were celebrating some kind of event there”

https://twitter.com/front_ukrainian/status/1761449228906221950

“Unconfirmed reports of a massive HIMARS strike on a Donetsk-area restaurant today.”

https://twitter.com/IntelCrab/status/1761435559245873344

44 posted on 02/24/2024 10:14:08 AM PST by SpeedyInTexas
[ Post Reply | Private Reply | To 43 | View Replies | Report Abuse]

To: FtrPilot

Cryptic hints that it was a poisoning or a bomb at a party.

45 posted on 02/24/2024 10:24:31 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 43 | View Replies | Report Abuse]

To: marcusmaximus

The partisan gals are still going strong with their poisoning of Orcs.

46 posted on 02/24/2024 10:51:54 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 45 | View Replies | Report Abuse]

To: Kazan
After, yet, unstoppable onslaught after unstoppable onslaught, the Moscovians control less of the Ukraine than they did two years ago.
47 posted on 02/24/2024 10:52:28 AM PST by Mr. Lucky
[ Post Reply | Private Reply | To 40 | View Replies | Report Abuse]

To: marcusmaximus
Some X threads claim "Many ambulances go to the hospital..." but no information on why.

Since there is no confirmation from Ukraine leadership, I'm guessing this is a partisan operation.

48 posted on 02/24/2024 10:54:38 AM PST by FtrPilot
[ Post Reply | Private Reply | To 45 | View Replies | Report Abuse]

To: FtrPilot; PIF

Very Cryptic partisan hints that ambulances are carrying officers of the Black Sea fleet.

49 posted on 02/24/2024 11:10:46 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 48 | View Replies | Report Abuse]

To: FtrPilot

Kremlin snuff box
https://t.me/s/kremlin_secrets

Second anniversary of the SVO. The Kremlin saw “bad signs” and thinks they are “not praying enough”

Successful attacks for the enemy on our A-50 aircraft and on the Novolipetsk Metallurgical Plant, which occurred before and on the second anniversary of the start of the Northern Military District in Ukraine, are “bad signs.”

This opinion was expressed to us by an influential source in the Kremlin. “A lot of bad things are happening. They hit the Lipetsk plant with drones, and now it won’t work for a month and a half or two.

“And this will have a bad impact on our military industry. Such an important plane was shot down. The President was going to fly on it, after all. Everything is somehow going wrong,” he said.

Our interlocutor is especially frightened by the fact that the A-50, right before the tragedy and was urgently consecrated with the icon of the Savior Not Made by Hands, which Vladimir Putin presented to the VKS.

“Is God really turning away from us? On the second anniversary of the SVO, it shows that we pray little, not enough. And that’s why we haven’t won yet. But it’s okay, let’s pray harder. We will fight better!” - says the source.

According to him, this opinion is shared by many influential people in the AP and in the army. The interlocutor refused to answer whether the President thinks the same.

At the same time, he reported that Patriarch Kirill recently proposed holding a large prayer service for Russian weapons. Vladimir Vladimirovich has not yet responded anything about his participation in this event.

Let us note that not everyone in our elites shares this opinion.

“The fact that we have not strengthened our air defense, often give ill-conceived orders, do not take care of people and persecute those who honestly talk about losses, is not connected with prayers.

Something just needs to change. “Not only In the Ministry of Defense,” a high-ranking source in the General Staff told us.

He refused to give forecasts about what events await us next within the framework of the North Military District.

50 posted on 02/24/2024 11:16:00 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 36 | View Replies | Report Abuse]


Navigation: use the links below to view more comments.
first 1-5051-100101-150151-200 ... 15,251-15,293 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Pings · MailBloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson

15,295 posted on 04/29/2025 3:40:54 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15252 | View Replies]

To: PIF

Gott mit Uns😂


15,296 posted on 04/29/2025 3:55:33 PM PDT by blitz128
[ Post Reply | Private Reply | To 50 | View Replies]

To: PIF

15,297 posted on 04/29/2025 5:59:00 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 422 | View Replies]

To: FtrPilot

15,298 posted on 04/29/2025 5:59:40 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 401 | View Replies]


15,299 posted on 04/29/2025 6:00:46 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15251 | View Replies]

To: JonPreston

15,300 posted on 04/29/2025 6:01:28 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15251 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,261-15,28015,281-15,30015,301-15,320 ... 22,001-22,013 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson