Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,001-15,02015,021-15,04015,041-15,060 ... 19,761-19,767 next last
To: BeauBo
At least 5 833 Russian officers have been eliminated in the Russian invasion of Ukraine since 24 February 2022. Weekly update: +33 newly registered.
Sources: public Russian obituaries and graves.

https://x.com/KilledInUkraine/status/1911753723212157074

15,021 posted on 04/20/2025 1:18:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15019 | View Replies]

To: AdmSmith

As long as putin is in charge there can be no peace.

With the Soviets attacking on the East and the allies moving through France and Germany being attacked from the air daily any person would know that Germany had already lost and it was just a matter of time.

The one person that could have ended the war with a word was hitler, but he chose not to because it was all about him and his desires.

Similarly this war is all about Putin’s dreams and desires. He could end this war today, but like hitler he knows it would be his end as well.


15,022 posted on 04/20/2025 4:26:11 AM PDT by blitz128
[ Post Reply | Private Reply | To 15017 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Incredible German Auto-Aiming Killer Drones Obliterate Russian Rear! ]

Today [ Apr 19, 8 pm ], there is a lot of news from Ukraine.

Here, Ukrainian special forces received Germany’s cutting-edge loitering munitions, powered with artificial intelligence for automatic targeting. Striking high-value targets deep behind enemy lines, Russians are struggling to find an answer against increasing number of high-tech Ukrainian strike drones appearing on the battlefield.

Recently, the Ukrainians received the first batch of the new German HF-1 loitering drones, which they immediately used to devastating effect. Combat footage from the Belgorod region reveals how the Ukrainians managed to successfully utilize the new loitering drones to destroy Russian Pantsir S1 and Buk M3 air defense systems, together with a Kupol radar, conducting the strikes at least 50km away from the frontline.

This showcased the effectiveness of the new German-made loitering drone, capable of flying for about an hour with an operational loitering range of 45–50km, and up to 100km when directed at a known target. Ukrainian Special Forces emphasized that this range allows strikes on Russian forces during staging, movement, or in rear positions where they are less alert.

Ukrainian forces can operate the HF-1 drone manually, guiding it toward preset targets and relying on terminal guidance to bypass Russian electronic warfare in the final phase of flight. However, the HF-1 drone is equipped with onboard AI that can autonomously detect, identify, and lock onto targets. A standout feature of the HF-1 is its wooden fuselage, made from plywood instead of plastic or composites.

This radio-transparent material reduces radar visibility and acts as a heat insulator, lowering the drone’s infrared signature and making it harder for air defenses to detect and engage with either radar or heat-seeking missiles and gun systems. Despite its unconventional construction, the wooden body has no negative impact on flight performance. HF-1 drones have also been used to eliminate key personnel, such as officers and commanders, evidenced by a strike on a vehicle at a Russian training ground, reportedly belonging to a unit commander.

Notably, Helsing, the company behind the HF-1, has also announced the ongoing production of 6,000 HX-2 strike drones, directly ordered by Ukraine. The HX-2 is an upgraded variant of the HF-1, offering over 100km of loitering range and an even longer direct strike range. Like its predecessor, it features an onboard AI system that can autonomously detect, re-identify, and engage targets without requiring a constant data link. Integrated with advanced software, HX-2 drones can operate together in coordinated swarms, allowing a single operator to target entire convoys or grouped-up targets at once. Designed for mass production at a lower cost than conventional systems, the HX-2 helps fill a gap in ongoing shortages of military equipment.

Ukraine is also ramping up domestic production of the U.S.-designed Switchblade 600 drones, a lighter-to-carry alternative to Javelin anti-tank missiles, at half the cost. Like the HF-1 and HX-2, the Switchblade 600 is a loitering munition. However, it carries a Javelin anti-tank warhead, detonating above the target where the armor is weakest, making it highly effective against armored targets. With a range of 40-80km and over 40 minutes of flight time, it has already proven its effectiveness by destroying advanced Russian armor, including Russian T-90M tanks and Terminator BMP’s, the most modern armored vehicles in Russia’s arsenal. Expanding their use within infantry units will significantly boost Ukraine’s anti-tank and deep-strike capabilities, even at the smallest tactical levels.

Overall, Ukraine has significantly bolstered its deep-strike capabilities with the deployment of German-made HF-1 loitering munitions, which have already proven effective against Russian air defenses and command vehicles deep behind the front lines. With 6,000 advanced HX-2 drones set to arrive in the near future, offering extended range, AI-driven swarm coordination, and strong resistance to electronic warfare, Ukrainians are positioned to escalate precision strikes on high-value Russian targets.

Meanwhile, Ukraine is increasing domestic production of the highly effective Switchblade 600, providing infantry with the firepower of a Javelin anti-tank missile at a much greater range, using a system that fits in their backpack. If effectively employed, these loitering munitions could seriously disrupt Russian logistics and planning and will potentially play a critical role in dismantling the summer offensive before it begins.

https://www.youtube.com/watch?v=_p0ExOfO7F8


15,023 posted on 04/20/2025 4:27:52 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15021 | View Replies]

To: blitz128

He cannot remain in power in a frozen conflict either, but needs ongoing war activities. The end of the war or a frozen conflict will lead to a crash of the Muscovy state’s economy and rebellion among generals and oligarchs.


15,024 posted on 04/20/2025 6:33:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15022 | View Replies]

To: AdmSmith

Its a mystery to me why 47 cannot see what Putin is all about? Why a “just and lasting peace” is impossible to achieve with Putin?


15,025 posted on 04/20/2025 6:58:54 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15024 | View Replies]

To: PIF

Not sure he doesn’t see that, but perhaps he is letting pitin show who he is through his actions and words.

We are still supplying weapons and intel to Ukraine.

I think that says a lot


15,026 posted on 04/20/2025 7:08:20 AM PDT by blitz128
[ Post Reply | Private Reply | To 15025 | View Replies]

To: blitz128

We are still supplying weapons and intel to Ukraine.


The hint is that aid may end, as 47 abandons Ukraine, like he has the rest of Europe.


15,027 posted on 04/20/2025 7:11:53 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15026 | View Replies]

To: AdmSmith

In more ways than one, he has converted his economy to war time footing. Turning that off is not easy.

Imagine the flood of soldiers from the front back home and the chaos that will cause and maintaining a huge standing army is too costly for Russia as well.

Lots of soldiers affected by war with little to do is a dangerous situation.

I remember a story anout how they had soldiers at forts cut the grass with scissors, not because they had to but that the soldiers needed to be kept busy

Idle hands….


15,028 posted on 04/20/2025 7:13:31 AM PDT by blitz128
[ Post Reply | Private Reply | To 15024 | View Replies]

To: PIF
"Today, Ukrainians deployed their latest breakthrough: a powerful new laser weapon capable of blinding, burning, and even bringing down Russian drones and missiles mid-flight."

The US Navy has tested similar weapons since circa 2014, but without broadly deploying them.

I think the issue for the US Navy is that lasers are not 100% reliable under all conditions (i.e., fog or smoke), but Ukrainians don't need 100% reliability.
They'll be happy with 90% against swarms of dozens of cheap Russian drones.
Then they can shoot down the other 10% with other weapons.

15,029 posted on 04/20/2025 7:20:10 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 15003 | View Replies]

To: BroJoeK; Dopey; zeeper
Please Zelensky, do not screw up this peace initiative.


15,030 posted on 04/20/2025 7:29:22 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15029 | View Replies]

To: PIF
The hint is that aid may end, as 47 abandons Ukraine, like he has the rest of Europe.

Please learn about MAGA, you NeverTrumps

15,031 posted on 04/20/2025 7:30:56 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15027 | View Replies]

To: BroJoeK

Maybe the directed-energy weapon is not a laser, it can operate at different frequencies than traditional lasers.


15,032 posted on 04/20/2025 8:23:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15029 | View Replies]

To: BroJoeK

The issue for the US Navy is they like big and expensive and hen they invariability run out of funds, one way or another, and cancel the whole thing.

The Japanese Navy is now fielding a rail gun, a concept the US Navy killed. UKR mid range drones are made out of plywood, a concept that would never enter a Naval weapons designer’s head.


15,033 posted on 04/20/2025 8:25:17 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15029 | View Replies]

To: Alert

🚨

#BREAKING: Zelensky has REJECTED Putin’s offer for an Easter ceasefire, per Washington Post

This guy has ZERO interest in peace.

NOT ANOTHER DIME for Ukraine. I’m tired of my tax dollars funding a meat grinder.

pic.twitter.com/8SVSH06Qzf— Nick Sortor (@nicksortor) April 19, 2025


15,034 posted on 04/20/2025 9:12:23 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15031 | View Replies]

To: PIF; AdmSmith; blitz128
"Its a mystery to me why 47 cannot see what Putin is all about?
Why a “just and lasting peace” is impossible to achieve with Putin?"

I don't think Pres. Trump is in the least blinded or deceived about Russia & Putin.
Rather, Trump recognizes China as the, by far, greater threat and he believes the Euros can, should & must take the lead in defending Ukraine against Russia.
Ukraine is a "trial by fire" for the Euros, and so, in Secretary Rubio's words: "Ukraine is not our war."

"Our war" is against CCP China, and Trump has already effectively declared war on China -- trade war, economic war, Naval buildup, shutting down China's spies, repeaters & influencers in the US, deporting illegal Chinese "immigrants", moving against Chinese takeovers of Panama & Greenland, decertifying Chinese corporations on the US stock exchange... the list of Trump's actions goes on and on.
In addition to CCP China, there are several other important threats, including Iran, the Middle East generally, plus Venezuela and other bad actors in the Western Hemisphere.

So, imho, Trump believes the US's chief responsibility regarding Russia vs. Ukraine is to discourage Vlad the Invader from launching nukes against Ukraine or the west.
That's what Trump's "peace negotiations" have been all about, not some deluded effort to see Russians as somehow other than murderous monsters.

Now consider: in WWII, US manufacturing outproduced the rest of the world combined and employed ~33% of the US workforce.
Today US manufacturing has shrunk to 8% of our workforce, while China's manufacturing at 33% of its workforce outproduces us about 8 to 1.

Especially concerning is CCP's shipbuilding, which currently supplies 50% of the world's commercial ships and is now outproducing the US Navy warships by several to one -- at least in quantity, if not yet in quality.
I think that's the "root cause" explanation for pretty much everything we see from the Trump administration these days.

Trump is not in the least "blind" to the obvious, but he is very concerned about threats other than those in Ukraine.

USS John F. Kennedy CVN-79 under construction in 2018.
Launched: 2019, Commissioned: 2025?, 1st Deployed: 2029?
CCP China produces smaller warships at the rate of several to every-one for the US Navy:

15,035 posted on 04/20/2025 9:17:28 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 15025 | View Replies]

To: BroJoeK
❗️The first footage of the appearance of 🇰🇵North Korean 240-mm M1991 MLRS in service with the 🇷🇺Russian Federation.

https://bsky.app/profile/militarynewsua.bsky.social/post/3lnagqcsub22b
45 s video

Russian servicemen install anti-drone protection on the M-1991 multiple launch rocket system supplied to the Armed Forces by North Korea. The North Korean equivalent of the Uragan is capable of hitting targets at a distance of up to 60 km.

If Korea and Iran had stopped arming Russia, this war would have ended long ago.
https://t.me/ButusovPlus/19199

15,036 posted on 04/20/2025 9:34:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15035 | View Replies]

To: PIF; BroJoeK

❗️The 🇬🇧British Army for the first time successfully tested a directed microwave weapon (RF DEW) against a group of UAVs.

It is capable of quickly and effectively neutralizing multiple air targets at a distance of up to one kilometer.
https://bsky.app/profile/militarynewsua.bsky.social/post/3lnaibzijrk2b
2 min video


15,037 posted on 04/20/2025 9:52:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15033 | View Replies]

To: BroJoeK

Hog wash


15,038 posted on 04/20/2025 10:19:49 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15035 | View Replies]

To: AdmSmith

Likely targets for the UKR wooden drones


15,039 posted on 04/20/2025 10:21:08 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15036 | View Replies]

To: BroJoeK

No doubt President Trump sees China as the major threat, however China is looking at how we react to Russia.

Interesting times


15,040 posted on 04/20/2025 11:08:11 AM PDT by blitz128
[ Post Reply | Private Reply | To 15035 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,001-15,02015,021-15,04015,041-15,060 ... 19,761-19,767 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson