Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 13,461-13,48013,481-13,50013,501-13,520 ... 18,761-18,762 next last
To: FtrPilot

Impossible, propaganda 😎


13,481 posted on 03/17/2025 2:33:42 PM PDT by blitz128
[ Post Reply | Private Reply | To 13476 | View Replies]

To: FtrPilot

13,482 posted on 03/17/2025 3:43:22 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13457 | View Replies]

To: FtrPilot

Russia has a notable space launch facility in Krasnodar, but also significant oil and Military Aviation assets.


13,483 posted on 03/17/2025 11:26:10 PM PDT by BeauBo ( )
[ Post Reply | Private Reply | To 13478 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, March 17, 2025

Russian officials continue to demonstrate that Russia’s aim of destroying Ukrainian sovereignty remains unchanged since before Russia launched its full-scale invasion in 2022. Russian Deputy Foreign Minister Alexander Grushko claimed in an interview with Kremlin-affiliated outlet Izvestiya on March 17 that Russia continues to demand that Ukraine be a neutral state and that NATO states refuse to accept Ukraine as a member.[5] Ukrainian Foreign Minister Andriy Sybiha stated to RBK Ukraine on March 17 that no country should have a “veto” over Ukraine’s choice to participate in alliances, including the EU or NATO.[6] Syhiba noted that Ukraine’s NATO aspirations are enshrined in the Ukrainian Constitution and reflect a “strategic choice of the Ukrainian people.” A Russian “veto” of Ukraine’s choices about these matters would amount to a denial of Ukraine’s ability to make choices about its alliances and security arrangements as a sovereign and independent state. Grushko acknowledged during his interview that Russia’s demands for Ukrainian neutrality and NATO’s refusal to allow Ukraine into the alliance are the same demands that Russia made in 2021 before its full-scale invasion of Ukraine — demonstrating how Russia’s demands to destroy Ukraine as an independent, sovereign state have remained unchanged.[7]

The Kremlin continues to reject the prospect of European peacekeepers in Ukraine, in opposition to US and Ukrainian positions on the matter and impeding the establishment of a stable, lasting peace to end the war. Grushko stated on March 17 that Russia will not accept peacekeepers from the EU, NATO, or individual Western states in post-war Ukraine as Russia considers all of these possible peacekeeping contingents to be “NATO contingents.”[8] Grushko claimed that any talks about future international peacekeeping missions in Ukraine should only occur after the conclusion of the final peace agreement to end the war and only if parties to the peace agreement agree that the peace agreement requires international support. The Kremlin appears to be trying to dictate the timing and sequence of talks, demanding that final peace talks precede any discussions about peacekeeping missions in post-war Ukraine.[9] Russia continues to make clear its rejection of any European involvement in post-war Ukraine — in contradiction to US and Ukrainian positions on the matter. Trump stated on February 26 that Europe should be responsible for security guarantees for Ukraine, and the joint US-Ukrainian March 11 statement outlining the temporary ceasefire proposal stated that Ukraine reiterated its positions that European partners should be involved in the peace process.[10] Sybiha stressed the importance of European support to assist in monitoring and enforcing the terms of a permanent ceasefire in Ukraine and noted that Ukraine is already discussing specific details with those European countries willing to deploy peacekeeping forces to Ukraine.[11] Significant European involvement in post-war Ukraine is critical for any peace settlement that aims to establish an enduring peace in Ukraine.

A strong Ukrainian military backed by security guarantees remains the most important component of a sustainable peace in Ukraine and deterrence of future Russian aggression. Sybiha emphasized that there can be no restriction on Ukraine’s defensive capabilities or military strength in any future peace agreement and that Ukraine must keep working towards a self-sufficient defense industrial sector to deter further Russian aggression.[12] Sybiha, responding to a question about Ukraine’s fundamental stipulations in “any” future negotiations, stated that Ukraine will not compromise its territorial integrity and sovereignty and “will never recognize occupied territories.” Discussions on the permanent status of occupied Ukrainian territory should properly only be a part of negotiations on a permanent settlement of the war.

The United States announced its withdrawal from war crimes monitoring agencies related to the war in Ukraine — essentially a unilateral concession to Russia with no Russian concessions in return. The New York Times, citing an internal letter from the US Department of Justice (DoJ), reported on March 17 that the US DoJ notified the International Center for the Prosecution of Crimes of Aggression (ICPA) against Ukraine that the United States would withdraw from the organization by the end of March 2025 after having participated in the organization since November 2023.[13]The EU Agency for Criminal Justice Cooperation (Eurojust), the ICPA’s parent organization, confirmed to SkyNews that the United States is withdrawing from the ICPA.[14] The ICPA is responsible for investigating the leaders directly accountable for crimes committed in the context of Russia’s full-scale invasion of Ukraine.[15]The New York Times also reported that the Trump administration intends to scale back the US DoJ’s War Crimes Accountability Team (WarCAT), which the US DoJ established in 2022 to coordinate the DoJ’s efforts to hold Russians accountable for war crimes committed in Ukraine.[16]

The Kremlin continues to nationalize private enterprises to support Russia’s defense industrial base (DIB). Russian business outlet Kommersant reported on March 17 that the Dalnegorsk District Court in Primorsky Krai granted the Russian state the full shares of JSC GMK Dalpolimetall.[72]Dalpolimetall is a mining and metallurgical enterprise that specializes in extracting lead and zinc concentrates, including for ammunition and military equipment production. Russian opposition outlet Meduza reported that the company’s reported revenue in 2023 amounted to 3.5 billion rubles ($41.9 million) and that the company’s assets are valued at about 32 billion rubles ($383 million), with mine assets valued at 270 billion rubles (roughly $3.2 billion).[73]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-17-2025


13,484 posted on 03/18/2025 2:13:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13440 | View Replies]

Day 1118 of the Russian invasion. 1,560, i.e. more than 65 Russians and Norks/h. Vehicles and fuel tanks more than 190% and artillery more than 90% above average.


13,485 posted on 03/18/2025 2:19:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13441 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...
Кремлевская табакерка

Who leaked the data on Putin's security guards?

In connection with the investigation into the employees of the presidential security service (part of the FSO), many rumors and discussions have appeared. In particular, where did the authors of the investigation get access to the film “Our Service” [1], which is so often referred to by “journalists”-foreign agents.

The interlocutors very carefully made it clear that the relations between the former FSO employees have clearly become tense. There are obvious conflicts between very influential groups and individuals. “If you believe that it is possible to simply track the movements of the president's security, then you are a very naive person. For those inside, it is clear where the legs are growing from. Who dreams of himself in the presidential chair ...”, - says a source from among the hawks in power.

And indeed, the investigation contains the following quote: “An interlocutor close to the Presidential Administration believes that Dyumin’s appointment (as an aide to the president - Ed.) is a test designed to show how ready the former security guard is to become a successor.” And to cover up, the words of another interlocutor are cited, who sees the appointment as an honorary pension for Dyumin, and recalls that he was the only one who publicly expressed condolences in connection with the death of Yevgeny Prigozhin.

Be that as it may, the degree of conflict between prominent former FSO members continues to grow. The struggle for “access to the body” has grown into a struggle for resources. Including those of a military nature.

https://t.me/kremlin_secrets/5425

1: The movie Our Service Наша служба https://www.youtube.com/watch?v=p57ikQ0l97Y
English subtitles

17 марта 2025 года All the President's Men. Who Protects Vladimir Putin

Belenky is a member of the Presidential Security Service (SBP), a key and essentially autonomous unit within the Federal Protective Service (FSO). The SBP is responsible not only for protecting the Russian leader but also for securing his many residences, preparing his meals, cleaning the premises, and even mowing the lawn at the Novo-Ogaryovo residence.

All food is carefully checked, including if Putin wants to cook fish he caught himself or game killed during a hunt. All dishes served to the president are first tasted by FSO officers in any case. “The president catches it and says: ‘I want to cook this fish for the evening.’ We call doctors who specialize in checking. Nothing is given without checking. There are mobile laboratories, there are express tests that show important points, so that there are no poisons, excess mercury, excess of some intestinal points,” the film says.

Dyumin has been guarding Putin since 1999. He himself recalled the scope of his duties as follows: “You must have complete control over the overall situation. Every morning begins with a report to the president on operational summaries. <…> Sometimes I had to pass on an assignment to a minister, set a task for the head of a region.” In 2016, Dyumin became governor of the Tula region, and in 2024, an aide to the president and secretary of the State Council. A Dossier source close to the presidential administration believes that Dyumin’s appointment is a test designed to show how ready he is to become a successor. Another source of the journalists, who also works with the AP, believes that this is more of an honorary pension for Dyumin.

While examining Putin's armored train, Dossier noted the presence of several communication devices: Ryabina-M radio receivers, Legend-2 R-439 satellite stations, the Azur signal processing complex, and the Azid radio relay station. These systems are far from modern—they have been used by the Russian military since the 1980s.

It is difficult to determine what equipment the FSO currently employs, as its procurement records are classified. However, Dossier analyzed contracts from 2014–2021, a period when some tenders were still publicly available. The buyers included the central and regional units of the Special Communications Service, the FSO’s Armament Directorate, and the Administrative Support Service.

The documents mention several key pieces of communication equipment: the R-169RRS radio relay station, MIK-RL and MIKRAN relay stations, the R-419MP Andromeda-D mobile radio relay station (mounted on a Kamaz truck and used by the military), the R-439-2P ground station, and dozens of additional components, including telephone sets with detailed specifications.

At Novo-Ogaryovo, antennas and receiver units for the radio relay station are mounted on a 63-meter tower. The signal is transmitted to Moscow State University on Vorobyovy Gory, where reception equipment is installed at a height of 116 meters.

Dossier consulted a military communications specialist to review the list of equipment. The expert, who requested anonymity for security reasons, concluded that the technology meets «high communication standards» and that details about antenna types would not help intercept the president's conversations: «The key factor is the software and signal-processing elements, which modify frequencies, interact with base stations, encrypt communications, and so on. Intercepting such signals—whether shortwave, longwave, or satellite—is extremely difficult and beyond the capabilities of most intelligence agencies.»

https://dossier.center/wp-content/uploads/2025/03/8374987239847329423.jpg

https://dossier.center/putinmen-en/

https://www.akm.ru/eng/news/gazprom-s-structure-bought-out-about-90-of-npf-mikran/

13,486 posted on 03/18/2025 4:22:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13483 | View Replies]

To: marcusmaximus; AdmSmith

“One Thing Is Clear – Trump Can’t Stand Us,” Says Ukrainian Official

A Ukrainian government official told The Economist that Donald Trump’s administration is unwilling to offer Kyiv unconditional support, unlike the previous U.S. president.

“In just seven weeks after Trump’s… pic.twitter.com/z2JkOEj23V— Zlatti71 (@Zlatti_71) March 18, 2025


13,487 posted on 03/18/2025 4:56:16 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 49 | View Replies]

To: AdmSmith
"A Ukrainian 3,000-kilometer-range drone has successfully passed testing. There was also a report on the use of Ukrainian missiles – the 1,000-kilometer-range Long Neptune missile, and we are satisfied with the strike results." – President Zelenskyy.

OSINT analysts and a number of media outlets, citing sources, claim that the Long Neptune strike was aimed at the Russian oil refinery in Tuapse, which is 550 kilometers from the front line. Experts interviewed by DW suggest that the missile is a new modification of the anti-ship Neptune (R-360).

Prior to the Long Neptune, the longest-range missiles used by Ukraine against Russia were only Western missiles – ATACMS and Storm Shadow (Scalp). According to open sources, Kyiv received these missiles with a range of up to 300 kilometers. However, according to media reports, Ukraine exhausted its stockpile of American ATACMS ballistic missiles in January 2025. At the same time, the number of Storm Shadow (Scalp) missiles is limited, as they were delivered by the dozens.

The main issue, according to Mykola Sunhurovskyi, director of military programs at the Razumkov Center, is mass production, because weapons make sense when they are used en masse. "How to scale production? It will be difficult. I hope that by combining the technological, production, and financial resources of Ukraine and Western partners, we will be able to scale this development."

https://x.com/Gerashchenko_en/status/1901952208683282810


13,488 posted on 03/18/2025 5:04:49 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13486 | View Replies]

To: AdmSmith

https://freerepublic.com/focus/f-news/4305013/posts

Guess Denise Prager is just another “zeeper”😂


13,489 posted on 03/18/2025 5:05:24 AM PDT by blitz128
[ Post Reply | Private Reply | To 13486 | View Replies]

To: blitz128
President of France Emmanuel Macron has called on French manufacturers to increase the volume of arms production. Paris is offering arms contracts to European countries.

As of 2023, France was among the top ten countries in the world in terms of military spending, as well as among the top five countries in the world in terms of military exports. (Ahead of it are the United States, Germany and China). France's military-industrial complex accounts for more than 25% of all European military capacity.

Since the start of the full-scale Russian invasion of Ukraine in 2022, France has made tremendous progress in its military industrial complex.

In an interview with Le Figaro in early 2025, the French President said he would like to allocate "about 3-3.5% of GDP" to defense instead of the current 2.1%. Army budgets are approved in the military planning law, the current law covers the period from 2024 to 2030 and envisages spending €413 billion. For 2025, €50.5 billion is allocated for defense spending. If France were to spend 3.5% of GDP (based on current levels), it would allocate €70 billion per year to defense.

France is one of the few European countries with a defense industry capable of developing weapons from start to finish without being dependent on the United States. Currently, the French military-industrial complex includes nine major industrial groups: Airbus Defense and Space, Ariane Group, Arquus, Dassault Aviation, MBDA, Naval Group, KNDS France, Safran, and Thales.

https://x.com/Gerashchenko_en/status/1901929996018696593

As of 2023, France was among the top ten countries in the world in terms of military spending, as well as among the top five countries in the world in terms of military exports.

Worth repeating!

13,490 posted on 03/18/2025 5:14:00 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13488 | View Replies]

To: blitz128

I can answer that. Prager is both a Neocon and a Zeeper.


13,491 posted on 03/18/2025 5:14:57 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13489 | View Replies]

To: BeauBo
Russian "don't move, the drone won't see you" tactic.

https://x.com/bayraktar_1love/status/1901955351655698648


13,492 posted on 03/18/2025 5:18:52 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13490 | View Replies]

To: BeauBo
Germany's Bundestag will vote on a massive infrastructure and defense package in a few moments, paving the way for over a half trillion euros in new spending.

During debate, future chancellor Merz called for a total rebuilding of Germany's defense capabilities.

https://x.com/Osinttechnical/status/1901959851854405909


13,493 posted on 03/18/2025 5:21:44 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13492 | View Replies]

To: FtrPilot

13,494 posted on 03/18/2025 5:22:43 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13493 | View Replies]

To: JonPreston

13,495 posted on 03/18/2025 5:23:17 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13494 | View Replies]

To: JonPreston

13,496 posted on 03/18/2025 5:23:39 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13495 | View Replies]

To: JonPreston

13,497 posted on 03/18/2025 5:24:13 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13496 | View Replies]

To: JonPreston

Sure 😎


13,498 posted on 03/18/2025 5:24:16 AM PDT by blitz128
[ Post Reply | Private Reply | To 13491 | View Replies]

To: JonPreston

⚡️ BREAKING: President Putin responded to President Trump regarding his appeal to spare Ukrainian soldiers in the Kursk region:

“We have read today’s appeal from President Trump to spare the lives of servicemen of the Ukrainian Army in the Kursk region. In this regard, please… pic.twitter.com/RmmbqO1oS3— 🇷🇺Russia is not Enemy (@RussiaIsntEnemy) March 14, 2025


13,499 posted on 03/18/2025 5:25:08 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13497 | View Replies]

To: JonPreston
Ursula Von Der Hitler


13,500 posted on 03/18/2025 5:25:31 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13499 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 13,461-13,48013,481-13,50013,501-13,520 ... 18,761-18,762 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson