Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,961-12,98012,981-13,00013,001-13,020 ... 18,701-18,717 next last
To: FtrPilot
Ukrainian paratroopers wiped out up to 80% of Russian troops trying to infiltrate via a gas pipeline in Kursk region – 🇺🇦 officer Hai said. Ukrainians knew the plan in advance and set up an ambush. At the right moment, the tunnel exit was sealed—trapping the invaders. No escape. Total destruction.

Translation:

https://bsky.app/profile/noelreports.com/post/3ljukkh7jbk2s

12,981 posted on 03/08/2025 7:12:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12979 | View Replies]

To: PIF
Ukraine's Air Force reported on another large Shahed drone and missile attack overnight.

Shot down:
0/2 Iskander-M/KN-23 ballistic missiles
1/1 Iskander-K cruise missiles
133/145 Shahed drones (79 shot down and 54 supressed by electronic warfare)

https://x.com/NOELreports/status/1898321966857158889


12,982 posted on 03/08/2025 7:23:57 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12980 | View Replies]

To: BeauBo
Defense Intelligence of Ukraine sabotaged a locomotive involved in Russian army logistics.

Overnight on March 6th, a successful operation was carried out on the railway in Voronezh, Russia. The locomotive supplied munitions and equipment from Russian factories to the occupied territories of Ukraine.

A few weeks before this, on February 19, Ukrainian intelligence also set fire to a cargo train in the Moscow region.

https://x.com/Gerashchenko_en/status/1898312256431046690

GoPro video of the action.


12,983 posted on 03/08/2025 7:44:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12982 | View Replies]

Russian logistics road, Pokrovsk front. Russians carry supplies on foot because roads are blocked by destroyed vehicles.

https://x.com/bayraktar_1love/status/1898308986689999095

Running low on donkeys?

12,984 posted on 03/08/2025 7:50:17 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12983 | View Replies]

To: BroJoeK

Don’t assume that Trump is naive.
Assume rather that he is negotiating in public so that Americans, and the world, can see how he gets from “point A” to “point B”.


On the backs of a lot of needlessly dead Ukraine civilians. While Russia faces only a threat of meaningless sanctions. Very fair.


12,985 posted on 03/08/2025 8:01:49 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12965 | View Replies]

To: BroJoeK

Trump has leaned hard on Ukrainians, I expect he will lean just as hard on Russia.


Expectations are like hope in a war - a fool’s errand.


12,986 posted on 03/08/2025 8:02:48 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12966 | View Replies]

To: AdmSmith

As Ukraine’s supply of US weapons decreases, the amount of Russian casualties falls, and the number of Ukrainian civilian & troop deaths rise.


12,987 posted on 03/08/2025 8:05:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12967 | View Replies]

To: AdmSmith

signal:
Russia is untouchable or else. Give us Ukraine. Non-negotiable.


12,988 posted on 03/08/2025 8:07:40 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12968 | View Replies]

To: FtrPilot

Lots of Russian GDP


12,989 posted on 03/08/2025 8:17:37 AM PST by blitz128
[ Post Reply | Private Reply | To 12984 | View Replies]

To: blitz128
The German defense giant Rheinmetall just revealed new footage of its Skyranger 35, a highly capable 35mm AAA turret mounted on a Leopard 1 chassis.

Ukraine is expected to receive a number of these units, with significant interoperability with the country's Leopard 1A5 fleet.

https://x.com/Osinttechnical/status/1898216434653700277


12,990 posted on 03/08/2025 8:19:15 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12989 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Game Over! Russians Capitulate in Pokrovsk! ]

Today [ Mar 07, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction.

Here, cut off, abandoned, and with no way out, Russian troops in and around Udachne found themselves trapped as Ukrainian forces tightened their grip around them.

One by one, soldiers emerged from hiding, not to fight, but to surrender en masse, marking yet another Russian indication that the tide is turning on the battlefield.

The goal of the Ukrainian forces in this area is to secure and consolidate control over the rest of the tree belt running along the railway line between Udachne and Pokrovsk. This is because these positions run perpendicular to the Russian route of advance as they try to encircle Pokrovsk from the west, which would force Russians back into full-frontal assaults, massively improving the overall defensive situation for the Ukrainians.

To accomplish this, Ukrainians are launching small but targeted maneuvers and operations, trying to achieve the biggest results with the least effort. This way, they significantly reduce manpower and equipment losses, allowing them to preserve these for future defensive or offensive operations.

After previously recapturing the trench network in the tree belt south of Udachne, Ukrainians had expertly positioned themselves to deny further Russian movement while eliminating a critical launching point for the Russian attacks.

The control of the stronghold along the tree line allows the Ukrainians to enforce fire control over the Russian attack and reinforcement routes towards Udachne, outflanking and forcing any surviving Russian soldiers to retreat from their positions or become encircled.

Furthermore, Russian soldiers and analysts are reporting that Russian forces around Pokrovsk are suffering from systemic issues, as the Russian commanders prioritize reporting success over actual gains on the battlefield.

This led to a reality where lower-ranking Russian officers were afraid of reporting any bad news, fearing their commanders would send them and their men on suicide missions in retaliation. It is important to note that this dynamic goes all the way up the ladder, as the top Russian military command placed high pressure on Colonel General Andrei Mordvichev to report Russian successes near Pokrovsk, which only increasingly contributed to false reports and misinformation.

On top of that, Ukrainians have increasingly implemented high-power electronic warfare systems, jamming the targeting equipment of glide bombs, drones, and radios, causing major communication issues for Russian soldiers. As a result, only a handful of more valuable Russian soldiers received the order to retreat in time.

Additionally, misleading battle reports caused a complete lack of awareness among the remaining Russian soldiers, most of whom were not even aware of the Ukrainian outflanking maneuver before it was too late.

To make the situation even worse for the Russians, Russian commanders had sent many wounded soldiers to Udachne in their desperation to achieve success, many of whom were by this point physically incapable of retreating. Overall, this resulted in many Russian soldiers finding themselves encircled and cut off by Ukrainian forces.

Geolocated footage reveals how after Ukrainians completed their encirclement, drone operators flew over known Russian positions, using megaphones outfitted on their drones, urging them to surrender. Subsequently, 1 video shows 5 Russian soldiers leaving their positions and following the drone to Ukrainian soldiers who were ready take them prisoner.

The footage shows how the Ukrainians had to help the men walk up an embankment in a weakened state after long neglect by their own armed forces.

Further footage shows how as the Ukrainian fighters then started moving through the tree belt, they encountered more and more Russian soldiers. who found themselves crawling towards them just to surrender and save their lives.

In the end, Russian high-level commanders abandoned many of their men, leading to a large number of Russian soldiers surrendering to the advancing Ukrainians. This issue was further worsened by false battle reports and jamming of radio communications by electronic warfare systems. Wounded soldiers had the highest incentive to surrender, as their arrival to the front would be a one-way trip either way.

After consolidating their control over the tree belt, the Ukrainians can now aim to push the Russian lines even further, threatening to eradicate the Russian bridgehead on the western flank of Pokrovsk and taking back complete control of the situation.


12,991 posted on 03/08/2025 8:23:34 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12984 | View Replies]

To: AdmSmith
💥👊 8 more reconnaissance UAVs destroyed by HORIZON GROUP of 81 OAeMBr

https://x.com/Maks_NAFO_FELLA/status/1898405555661943215


12,992 posted on 03/08/2025 8:27:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12990 | View Replies]

To: blitz128
Ukrainian drones targeted one of Russia's largest oil refineries, the “Kirishinefteorgsintez” (KINEF) plant in the Leningrad region. Russia claims only a tank was damaged. Air defense reported shooting down two drones, with debris causing external damage to the tank.

https://bsky.app/profile/wartranslated.bsky.social/post/3ljtzreu27s2r
8sec video

Before

During attack

The largest oil refinery in Russia in terms of the amount of fuel produced

The KINEF trade union is one of the largest in the Russian chemical industry; in 2016, 99.7% of the enterprise's seven thousand strong workforce were members of the organization. The chairman of the KINEF trade union is Viktor Ivanovich Flotsky

https://ru.wikipedia.org/wiki/%D0%9A%D0%B8%D1%80%D0%B8%D1%88%D0%B8%D0%BD%D0%B5%D1%84%D1%82%D0%B5%D0%BE%D1%80%D0%B3%D1%81%D0%B8%D0%BD%D1%82%D0%B5%D0%B7

12,993 posted on 03/08/2025 8:29:30 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12989 | View Replies]

To: PIF
🔥 🇺🇦 Favorit Company inflicts heavy losses on 🇷🇺 Russian invaders with FPV drones.

This is the kind of negotiation we like.

https://x.com/GloOouD/status/1898404744554520878


12,994 posted on 03/08/2025 8:35:30 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12992 | View Replies]

To: blitz128

Which is it 🍈 , Trump or camel toe that is your favorite? Or does it depend on your daily memo from the Kremlin?


12,995 posted on 03/08/2025 8:44:34 AM PST by blitz128
[ Post Reply | Private Reply | To 12989 | View Replies]

To: AdmSmith

Gonna take a lot more drones for a place that big.


12,996 posted on 03/08/2025 9:15:10 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12993 | View Replies]

To: blitz128

🍈’s daily memo comes in his office in-box


12,997 posted on 03/08/2025 9:16:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12995 | View Replies]

To: PIF
Special delivery for you, Mother PIF

“If Ukraine doesn't want to settle, then we are out of there."

I am doing this to save lives, not for money!”
- President Trump

pic.twitter.com/wH4Q9Yy2v5— US Homeland Security News (@defense_civil25) March 7, 2025


12,998 posted on 03/08/2025 9:32:41 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12997 | View Replies]

To: blitz128
🍈

Here you go Mumbles, from Grok

A "dimwit" is a slang term used to describe someone who is perceived as foolish, stupid, or lacking intelligence. It’s a casual, mildly insulting way to point out someone’s apparent lack of common sense or understanding. For example, you might call someone a dimwit if they consistently miss the point or do something obviously silly. The word itself combines "dim" (meaning not bright or clear) with "wit" (meaning intelligence or cleverness), so it’s literally suggesting a person’s mental light bulb isn’t shining too brightly. Anything else you want to dig into about this?

12,999 posted on 03/08/2025 9:34:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12995 | View Replies]

To: PIF
PIf, are you a NeverTrump?


13,000 posted on 03/08/2025 9:36:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12996 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,961-12,98012,981-13,00013,001-13,020 ... 18,701-18,717 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson